Transcript: Human XM_011509381.3

PREDICTED: Homo sapiens nuclear receptor subfamily 5 group A member 2 (NR5A2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NR5A2 (2494)
Length:
6530
CDS:
1820..3325

Additional Resources:

NCBI RefSeq record:
XM_011509381.3
NBCI Gene record:
NR5A2 (2494)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509381.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019656 GCGTTGTCCTTACTGTCGTTT pLKO.1 2107 CDS 100% 4.950 6.930 N NR5A2 n/a
2 TRCN0000349608 GCGTTGTCCTTACTGTCGTTT pLKO_005 2107 CDS 100% 4.950 6.930 N NR5A2 n/a
3 TRCN0000019654 CCGAGTCCATAATGGGCTATT pLKO.1 2541 CDS 100% 10.800 8.640 N NR5A2 n/a
4 TRCN0000319276 CCGAGTCCATAATGGGCTATT pLKO_005 2541 CDS 100% 10.800 8.640 N NR5A2 n/a
5 TRCN0000019655 GCTCTTTAGTTTAGATGTCAA pLKO.1 3064 CDS 100% 4.950 3.465 N NR5A2 n/a
6 TRCN0000019657 GCTGGACTACACAATGTGTAA pLKO.1 3142 CDS 100% 4.950 3.465 N NR5A2 n/a
7 TRCN0000319277 GCTGGACTACACAATGTGTAA pLKO_005 3142 CDS 100% 4.950 3.465 N NR5A2 n/a
8 TRCN0000019658 CCTCTACTACAAGCACCTGAA pLKO.1 3247 CDS 100% 4.050 2.835 N NR5A2 n/a
9 TRCN0000319345 CCTCTACTACAAGCACCTGAA pLKO_005 3247 CDS 100% 4.050 2.835 N NR5A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509381.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00593 pDONR223 100% 95% 94% None (many diffs) n/a
2 ccsbBroad304_00593 pLX_304 0% 95% 94% V5 (many diffs) n/a
3 TRCN0000492135 TCCAGCTCACAGAAAAGCGCCCCC pLX_317 28.3% 95% 94% V5 (many diffs) n/a
Download CSV