Transcript: Human XM_011509838.2

PREDICTED: Homo sapiens leucine rich repeat containing G protein-coupled receptor 6 (LGR6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LGR6 (59352)
Length:
3328
CDS:
75..2777

Additional Resources:

NCBI RefSeq record:
XM_011509838.2
NBCI Gene record:
LGR6 (59352)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358434 CCTTTGCTTCACACGTGTAAA pLKO_005 2758 CDS 100% 13.200 18.480 N LGR6 n/a
2 TRCN0000358433 ACTCAGCAGTGTGATCTATAG pLKO_005 2869 3UTR 100% 10.800 7.560 N LGR6 n/a
3 TRCN0000063619 GCATTCCAGTACCTGCCTAAA pLKO.1 771 CDS 100% 10.800 7.560 N LGR6 n/a
4 TRCN0000063620 CCTGTGAGTACCTCTTTGAAA pLKO.1 1534 CDS 100% 5.625 3.938 N LGR6 n/a
5 TRCN0000063621 CGGTGCCTACATCAAACTGTA pLKO.1 2117 CDS 100% 4.950 3.465 N LGR6 n/a
6 TRCN0000063618 GAGGGAAGTAAAGACAGTGAA pLKO.1 3069 3UTR 100% 4.950 3.465 N LGR6 n/a
7 TRCN0000063622 GTGTCAGAAATTGGAGGAAAT pLKO.1 989 CDS 100% 10.800 6.480 N LGR6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08788 pDONR223 100% 95.1% 93.2% None (many diffs) n/a
2 ccsbBroad304_08788 pLX_304 0% 95.1% 93.2% V5 (many diffs) n/a
3 TRCN0000476522 CCCCTGTAATACTAGAGGTCCATA pLX_317 11.7% 95.1% 93.2% V5 (many diffs) n/a
4 TRCN0000488977 TTTGGGGCAATGTCTCGAAATCGT pLX_317 10.7% 94.7% 93.1% V5 (many diffs) n/a
5 TRCN0000488269 CTCCACATTCGCGACATTAACTCG pLX_317 12.4% 94.8% 93.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV