Transcript: Human XM_011509910.3

PREDICTED: Homo sapiens G protein-coupled receptor 89A (GPR89A), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR89A (653519)
Length:
902
CDS:
118..861

Additional Resources:

NCBI RefSeq record:
XM_011509910.3
NBCI Gene record:
GPR89A (653519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509910.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243822 GAATAGCAGCTCCCGTTATTT pLKO_005 315 CDS 100% 15.000 7.500 Y GPR89A n/a
2 TRCN0000243824 ATGTGACTGACACGGATATTC pLKO_005 656 CDS 100% 13.200 6.600 Y GPR89A n/a
3 TRCN0000358298 ATTACCTCCCAGATACTATTT pLKO_005 148 CDS 100% 13.200 6.600 Y GPR89B n/a
4 TRCN0000243823 GATTACCTCCCAGATACTATT pLKO_005 147 CDS 100% 13.200 6.600 Y GPR89A n/a
5 TRCN0000363142 TGAATAGCAGCTCCCGTTATT pLKO_005 314 CDS 100% 13.200 6.600 Y GPR89B n/a
6 TRCN0000243821 ACTATGAGATACGTCAGTATG pLKO_005 212 CDS 100% 10.800 5.400 Y GPR89A n/a
7 TRCN0000358303 CAATATCCGACTACTGCATAA pLKO_005 417 CDS 100% 10.800 5.400 Y GPR89B n/a
8 TRCN0000014505 CGCCAATTGTTTAAAGACTAT pLKO.1 196 CDS 100% 4.950 2.475 Y GPR89B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509910.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489448 TTCGCTAATGTGAAGCACCGCCCG pLX_317 23.4% 53.7% 53.5% V5 (many diffs) n/a
2 ccsbBroadEn_14517 pDONR223 100% 53.6% 1.6% None (many diffs) n/a
3 ccsbBroad304_14517 pLX_304 0% 53.6% 1.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000479192 GTTGGTCCATCTGCCGAGCCGACT pLX_317 29.6% 53.6% 1.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV