Transcript: Human XM_011510137.3

PREDICTED: Homo sapiens Rho/Rac guanine nucleotide exchange factor 2 (ARHGEF2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGEF2 (9181)
Length:
4779
CDS:
301..3690

Additional Resources:

NCBI RefSeq record:
XM_011510137.3
NBCI Gene record:
ARHGEF2 (9181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510137.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338254 CAATGTGGACGAGGGTATTTA pLKO_005 2010 CDS 100% 15.000 21.000 N ARHGEF2 n/a
2 TRCN0000338253 TCCGTTTCTCTTCGAAGTAAG pLKO_005 1048 CDS 100% 10.800 15.120 N ARHGEF2 n/a
3 TRCN0000003175 CGATGCCCTGTACTTGAGTTT pLKO.1 3399 CDS 100% 4.950 6.930 N ARHGEF2 n/a
4 TRCN0000010764 GCGGCGAATTAAGATGGAGTT pLKO.1 2499 CDS 100% 4.050 5.670 N ARHGEF2 n/a
5 TRCN0000003173 CGTAGGCAATTAGAGATCGAA pLKO.1 4428 3UTR 100% 3.000 4.200 N ARHGEF2 n/a
6 TRCN0000338199 GGCTTACCTGCGGCGAATTAA pLKO_005 2490 CDS 100% 15.000 12.000 N ARHGEF2 n/a
7 TRCN0000338202 TCTAGCCAGAGGGATCGAAAT pLKO_005 2890 CDS 100% 10.800 7.560 N ARHGEF2 n/a
8 TRCN0000003174 CGCTCTGTCCATCGAAACTTT pLKO.1 3475 CDS 100% 5.625 3.938 N ARHGEF2 n/a
9 TRCN0000003176 CCCAACCTGCAATGTGACTAT pLKO.1 933 CDS 100% 4.950 3.465 N ARHGEF2 n/a
10 TRCN0000338198 CCCAACCTGCAATGTGACTAT pLKO_005 933 CDS 100% 4.950 3.465 N ARHGEF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510137.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11345 pDONR223 100% 84.9% 84.9% None 1_510del n/a
2 ccsbBroad304_11345 pLX_304 0% 84.9% 84.9% V5 1_510del n/a
3 TRCN0000468482 GATTAACGCATCTTACAAGATGTC pLX_317 13.8% 84.9% 84.9% V5 1_510del n/a
Download CSV