Transcript: Human XM_011510171.2

PREDICTED: Homo sapiens CD48 molecule (CD48), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD48 (962)
Length:
1197
CDS:
256..891

Additional Resources:

NCBI RefSeq record:
XM_011510171.2
NBCI Gene record:
CD48 (962)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438737 GGCGCACTGTACATCTCTAAG pLKO_005 433 CDS 100% 10.800 15.120 N CD48 n/a
2 TRCN0000057665 CCCGGTCCTTTGGAGTAGAAT pLKO.1 812 CDS 100% 5.625 7.875 N CD48 n/a
3 TRCN0000057664 GTGTGCTTGAAACCACCCTTA pLKO.1 695 CDS 100% 4.050 5.670 N CD48 n/a
4 TRCN0000057667 GCGAGTCTGTAAACTACACCT pLKO.1 632 CDS 100% 2.640 3.696 N CD48 n/a
5 TRCN0000057666 CCCACCATTCTTGGCCTGTTA pLKO.1 862 CDS 100% 4.950 3.465 N CD48 n/a
6 TRCN0000057663 CCTGAGAACTACAAACAACTA pLKO.1 307 CDS 100% 4.950 3.465 N CD48 n/a
7 TRCN0000431647 GCTGAATTATCAACGAGGATT pLKO_005 1000 3UTR 100% 4.950 3.465 N CD48 n/a
8 TRCN0000417002 TCTAAGTACTTTGAATCCAAA pLKO_005 379 CDS 100% 4.950 3.465 N CD48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00260 pDONR223 100% 86.6% 86.8% None 0_1ins96;352C>T n/a
2 ccsbBroadEn_10719 pDONR223 100% 49.3% 42% None (many diffs) n/a
3 ccsbBroad304_10719 pLX_304 0% 49.3% 42% V5 (many diffs) n/a
4 TRCN0000474468 TCCCTCAATTGAGACCGAATCTGC pLX_317 70% 49.3% 42% V5 (many diffs) n/a
Download CSV