Transcript: Human XM_011510355.2

PREDICTED: Homo sapiens trafficking protein particle complex 12 (TRAPPC12), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRAPPC12 (51112)
Length:
1465
CDS:
93..1355

Additional Resources:

NCBI RefSeq record:
XM_011510355.2
NBCI Gene record:
TRAPPC12 (51112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417608 ATCATTCGGTTATCAAGTATT pLKO_005 850 CDS 100% 13.200 18.480 N TRAPPC12 n/a
2 TRCN0000454928 GCAAAGAGACAAGTCCTAAAT pLKO_005 246 CDS 100% 13.200 18.480 N TRAPPC12 n/a
3 TRCN0000136321 CCTGATGAAGGATTATGTGCT pLKO.1 815 CDS 100% 2.640 2.112 N TRAPPC12 n/a
4 TRCN0000134971 CAGAATGCTGAGATGGAATTT pLKO.1 471 CDS 100% 13.200 9.240 N TRAPPC12 n/a
5 TRCN0000427957 CCTTCACCTCGGGCAGAATAA pLKO_005 1031 CDS 100% 13.200 9.240 N TRAPPC12 n/a
6 TRCN0000426819 TCTTGATCAGCCAGATCTTTA pLKO_005 506 CDS 100% 13.200 9.240 N TRAPPC12 n/a
7 TRCN0000136810 CCACAGGTTCTTCACAGAGAT pLKO.1 1064 CDS 100% 4.950 3.465 N TRAPPC12 n/a
8 TRCN0000137130 CTTCAACCTGACCACCATGTA pLKO.1 1229 CDS 100% 4.950 3.465 N TRAPPC12 n/a
9 TRCN0000137444 GCCAATTTGGAGCAAGGCTTA pLKO.1 684 CDS 100% 4.050 2.835 N TRAPPC12 n/a
10 TRCN0000134866 CTTCACAGAGATCTTAAGGAT pLKO.1 1073 CDS 100% 3.000 2.100 N TRAPPC12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11951 pDONR223 100% 90.1% 90.2% None 1_123del;897T>C n/a
2 ccsbBroad304_11951 pLX_304 0% 90.1% 90.2% V5 1_123del;897T>C n/a
3 TRCN0000467963 GACTACTTTGTCCTTGACACGCTG pLX_317 37.7% 90.1% 90.2% V5 1_123del;897T>C n/a
Download CSV