Transcript: Human XM_011510752.2

PREDICTED: Homo sapiens solute carrier family 16 member 14 (SLC16A14), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC16A14 (151473)
Length:
2233
CDS:
455..1900

Additional Resources:

NCBI RefSeq record:
XM_011510752.2
NBCI Gene record:
SLC16A14 (151473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510752.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038564 CCTCTCTATTTACAAATCGAA pLKO.1 1377 CDS 100% 3.000 2.400 N SLC16A14 n/a
2 TRCN0000432386 TTTCCCTCTGACGTCAATTAT pLKO_005 1510 CDS 100% 15.000 10.500 N SLC16A14 n/a
3 TRCN0000426797 ACCTCCCAGAAATCGTCAATT pLKO_005 1461 CDS 100% 13.200 9.240 N SLC16A14 n/a
4 TRCN0000038568 GACTGGTATTCGGGCTACTTT pLKO.1 1349 CDS 100% 5.625 3.938 N SLC16A14 n/a
5 TRCN0000038567 CGGCATCATCATCTGTGCTAA pLKO.1 1780 CDS 100% 4.950 3.465 N SLC16A14 n/a
6 TRCN0000038565 CTCCTCTTTCTTTGTGCACAT pLKO.1 568 CDS 100% 4.050 2.835 N SLC16A14 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2186 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510752.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05051 pDONR223 100% 91.5% 91.1% None (many diffs) n/a
2 ccsbBroad304_05051 pLX_304 0% 91.5% 91.1% V5 (many diffs) n/a
3 TRCN0000474831 ACTGATAGTACCAGCTTAGCAGTC pLX_317 27.8% 91.5% 91.1% V5 (many diffs) n/a
Download CSV