Transcript: Human XM_011510950.2

PREDICTED: Homo sapiens TRAF3 interacting protein 1 (TRAF3IP1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRAF3IP1 (26146)
Length:
3136
CDS:
112..1155

Additional Resources:

NCBI RefSeq record:
XM_011510950.2
NBCI Gene record:
TRAF3IP1 (26146)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063586 GTATCAATTTGACTTCGAGAA pLKO.1 1130 CDS 100% 4.050 5.670 N TRAF3IP1 n/a
2 TRCN0000063585 GAGTCACACAATTCTGACAAT pLKO.1 568 CDS 100% 4.950 3.960 N TRAF3IP1 n/a
3 TRCN0000421123 AGTCTGCGGTGTGAGAATATT pLKO_005 292 CDS 100% 15.000 10.500 N TRAF3IP1 n/a
4 TRCN0000418483 TGTAAGCATGTTAAGTGTATT pLKO_005 1303 3UTR 100% 13.200 9.240 N TRAF3IP1 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2587 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2587 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07995 pDONR223 99.2% 47.8% 43.1% None (many diffs) n/a
2 ccsbBroad304_07995 pLX_304 0% 47.8% 43.1% V5 (many diffs) n/a
3 TRCN0000471623 TCAAGATTATCAAACTAGGGCTAT pLX_317 26.6% 47.8% 43.1% V5 (many diffs) n/a
4 TRCN0000489540 TAGGTATCGCTAGCTGATTAAACG pLX_317 20.1% 47.8% 43.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV