Transcript: Human XM_011511518.1

PREDICTED: Homo sapiens prothymosin alpha (PTMA), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTMA (5757)
Length:
1938
CDS:
457..1248

Additional Resources:

NCBI RefSeq record:
XM_011511518.1
NBCI Gene record:
PTMA (5757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135421 GTAGACGAAGAAGAGGAAGAA pLKO.1 1069 CDS 100% 4.950 3.465 N PTMA n/a
2 TRCN0000133816 CCAAACCATGAGAATTTGCAA pLKO.1 1416 3UTR 100% 3.000 2.100 N PTMA n/a
3 TRCN0000138750 GAAGTTGTGGAAGAGGCAGAA pLKO.1 976 CDS 100% 4.050 2.430 N PTMA n/a
4 TRCN0000138711 GAAGATGAGGAAGCTGAGTCA pLKO.1 1147 CDS 100% 2.640 1.584 N PTMA n/a
5 TRCN0000138955 GATGAGGATGACGATGTCGAT pLKO.1 1195 CDS 100% 2.640 1.584 N PTMA n/a
6 TRCN0000429553 TATTCCGAGCATTCCAGTAAC pLKO_005 1715 3UTR 100% 10.800 5.400 Y PTMA n/a
7 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 1099 CDS 100% 4.950 2.475 Y PTMA n/a
8 TRCN0000125359 CTGTACTATAAGTAGTTGGTT pLKO.1 1756 3UTR 100% 3.000 1.500 Y Ptma n/a
9 TRCN0000136081 GAAGATGATGAGGATGACGAT pLKO.1 1189 CDS 100% 2.640 1.320 Y PTMA n/a
10 TRCN0000138110 GCAGCTGAAGATGATGAGGAT pLKO.1 1183 CDS 100% 2.640 1.320 Y PTMA n/a
11 TRCN0000134223 GCTGTACTATAAGTAGTTGGT pLKO.1 1755 3UTR 100% 2.640 1.320 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01339 pDONR223 100% 39.6% 34.7% None (many diffs) n/a
2 ccsbBroad304_01339 pLX_304 0% 39.6% 34.7% V5 (many diffs) n/a
3 TRCN0000475496 AATGTAGACTACCTTGACCGGGAC pLX_317 64.5% 39.6% 34.7% V5 (many diffs) n/a
4 ccsbBroadEn_15553 pDONR223 0% 39.4% 34.4% None (many diffs) n/a
5 ccsbBroad304_15553 pLX_304 0% 39.4% 34.4% V5 (many diffs) n/a
6 TRCN0000478994 AAGACCGGGAGATGACTCTCGTTT pLX_317 100% 39.4% 34.4% V5 (many diffs) n/a
Download CSV