Transcript: Human XM_011511687.1

PREDICTED: Homo sapiens bone morphogenetic protein receptor type 2 (BMPR2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BMPR2 (659)
Length:
12084
CDS:
1166..4279

Additional Resources:

NCBI RefSeq record:
XM_011511687.1
NBCI Gene record:
BMPR2 (659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144883 AGCAACTGGACGCTCATCCA pXPR_003 AGG 667 21% 6 1.1619 BMPR2 BMPR2 76391
2 BRDN0001144950 CCTTTGGGAGAAATCAAAAG pXPR_003 GGG 220 7% 2 0.1429 BMPR2 BMPR2 76390
3 BRDN0001146229 CAGCACACCTTTGACTATAG pXPR_003 GGG 1735 56% 12 0.0542 BMPR2 BMPR2 76389
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511687.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197218 GAACGGCTATGTGCGTTTAAA pLKO.1 1256 CDS 100% 15.000 21.000 N BMPR2 n/a
2 TRCN0000000456 GCCTATGGAGTGAAATTATTT pLKO.1 4291 3UTR 100% 15.000 21.000 N BMPR2 n/a
3 TRCN0000194669 CCGAACTAATTCCAATAACAA pLKO.1 3859 CDS 100% 5.625 7.875 N BMPR2 n/a
4 TRCN0000000460 CAATCCAATGTCTACTGCTAT pLKO.1 2719 CDS 100% 4.950 6.930 N BMPR2 n/a
5 TRCN0000000458 CGCAGAATCAAGAACGGCTAT pLKO.1 1245 CDS 100% 4.050 5.670 N BMPR2 n/a
6 TRCN0000218801 ATTACCACGAGGAGATCATTA pLKO_005 2119 CDS 100% 13.200 10.560 N Bmpr2 n/a
7 TRCN0000194724 CCCTCTCTTGATCTAGATAAT pLKO.1 1751 CDS 100% 13.200 9.240 N BMPR2 n/a
8 TRCN0000195156 CCTAACTGTATACCAGAATTA pLKO.1 7062 3UTR 100% 13.200 9.240 N BMPR2 n/a
9 TRCN0000196987 GCTACAACCATGGTGTCTAAA pLKO.1 4235 CDS 100% 13.200 9.240 N BMPR2 n/a
10 TRCN0000195509 CCCAAGAAATGTTGCAGAATC pLKO.1 3693 CDS 100% 10.800 7.560 N BMPR2 n/a
11 TRCN0000196253 GCTACCTGATTTCTTACTTTC pLKO.1 4938 3UTR 100% 10.800 7.560 N BMPR2 n/a
12 TRCN0000022529 GCCAAGATGAATACAATCAAT pLKO.1 3530 CDS 100% 5.625 3.938 N Bmpr2 n/a
13 TRCN0000000459 GCCGTCTTGCTCATTCTGTTA pLKO.1 2070 CDS 100% 4.950 3.465 N BMPR2 n/a
14 TRCN0000000457 GCCCGCTTTATAGTTGGAGAT pLKO.1 1937 CDS 100% 4.050 2.835 N BMPR2 n/a
15 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 9118 3UTR 100% 4.950 2.475 Y ERAP2 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 9119 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511687.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00169 pDONR223 100% 99.9% 99.8% None 2866_2867insTAG n/a
2 ccsbBroad304_00169 pLX_304 0% 99.9% 99.8% V5 2866_2867insTAG n/a
3 TRCN0000469790 TAATTGCCGGGGTACCCGGTCTAC pLX_317 14.1% 99.9% 99.8% V5 2866_2867insTAG n/a
4 ccsbBroadEn_14551 pDONR223 0% 99.9% 99.8% None 2866_2867insTAG n/a
5 ccsbBroad304_14551 pLX_304 0% 99.9% 99.8% V5 2866_2867insTAG n/a
6 TRCN0000470982 TGCGCCGTGGTGTACAAAAACGGA pLX_317 12.7% 99.9% 99.8% V5 2866_2867insTAG n/a
7 TRCN0000488108 GGGCTTCCCTTATTTTATGTAACA pLX_317 9.6% 99.8% 99.6% V5 (not translated due to prior stop codon) 67A>G;1590C>A;2866_2867insTAG n/a
8 TRCN0000487951 CCATATCACGCACGTGGACTCCCT pLX_317 7.1% 99.8% 99.5% V5 (many diffs) n/a
Download CSV