Transcript: Human XM_011511864.2

PREDICTED: Homo sapiens IQ motif containing with AAA domain 1 (IQCA1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IQCA1 (79781)
Length:
2537
CDS:
34..2523

Additional Resources:

NCBI RefSeq record:
XM_011511864.2
NBCI Gene record:
IQCA1 (79781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511864.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421758 ATTAGCCACCTTCTACGTAAA pLKO_005 177 CDS 100% 10.800 15.120 N IQCA1 n/a
2 TRCN0000418473 CCTCGGTGCTTTACTCGATAA pLKO_005 102 CDS 100% 10.800 15.120 N IQCA1 n/a
3 TRCN0000138576 CCTTCGATGCTGAACTCCAAT pLKO.1 2105 CDS 100% 4.950 6.930 N IQCA1 n/a
4 TRCN0000135076 CCAAGGACATATAGTCGAAGT pLKO.1 2280 CDS 100% 4.050 5.670 N IQCA1 n/a
5 TRCN0000420909 AGACCATACAACAGGTTATTG pLKO_005 1052 CDS 100% 13.200 9.240 N IQCA1 n/a
6 TRCN0000134914 CTCTAACATTGCTGGGAAATA pLKO.1 1857 CDS 100% 13.200 9.240 N IQCA1 n/a
7 TRCN0000427745 ATATTAGCGGACAGCGGAATA pLKO_005 475 CDS 100% 10.800 7.560 N IQCA1 n/a
8 TRCN0000135122 CCAGTGTACAAAGAGGAAGAA pLKO.1 2395 CDS 100% 4.950 3.465 N IQCA1 n/a
9 TRCN0000134193 CTTTAAGAACTGGTATGCCAA pLKO.1 2421 CDS 100% 2.640 1.584 N IQCA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511864.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04124 pDONR223 100% 99% 98.7% None 4A>T;7_27del;31_32delAGinsGC n/a
2 ccsbBroad304_04124 pLX_304 0% 99% 98.7% V5 4A>T;7_27del;31_32delAGinsGC n/a
3 TRCN0000472214 TATATTGTAAGCCACCTATCACCT pLX_317 13.1% 99% 98.7% V5 4A>T;7_27del;31_32delAGinsGC n/a
Download CSV