Transcript: Human XM_011512082.2

PREDICTED: Homo sapiens macrophage receptor with collagenous structure (MARCO), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MARCO (8685)
Length:
1828
CDS:
122..1684

Additional Resources:

NCBI RefSeq record:
XM_011512082.2
NBCI Gene record:
MARCO (8685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512082.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422577 CGCATGCTGGGTTACTCCAAA pLKO_005 1502 CDS 100% 4.950 6.930 N MARCO n/a
2 TRCN0000029661 CCGTCAGGATTGTCGGCAGTA pLKO.1 1389 CDS 100% 1.350 1.890 N MARCO n/a
3 TRCN0000436721 GGCAGATCTGGCTGGATAATG pLKO_005 1557 CDS 100% 13.200 9.240 N MARCO n/a
4 TRCN0000029659 CCAGGGATGTTCAGAATCAAA pLKO.1 542 CDS 100% 5.625 3.938 N MARCO n/a
5 TRCN0000431418 CCTAGCTGTGGTGGTCATCTA pLKO_005 256 CDS 100% 4.950 3.465 N MARCO n/a
6 TRCN0000425995 CTCTTGAGTGAGACCCAACAA pLKO_005 155 CDS 100% 4.950 3.465 N MARCO n/a
7 TRCN0000029662 CCAAATTGCAATGGAGCCTTT pLKO.1 187 CDS 100% 4.050 2.835 N MARCO n/a
8 TRCN0000029660 CCTGGAGATGTATTTCCTCAA pLKO.1 349 CDS 100% 4.050 2.835 N MARCO n/a
9 TRCN0000029663 CGGGCTGAAGTTTACTACAGT pLKO.1 1421 CDS 100% 3.000 2.100 N MARCO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512082.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07285 pDONR223 100% 99.9% 100% None 471T>C n/a
2 ccsbBroad304_07285 pLX_304 0% 99.9% 100% V5 471T>C n/a
3 TRCN0000467928 GACCTGATACTATCCCCGGCGCTC pLX_317 26.3% 99.9% 100% V5 471T>C n/a
Download CSV