Transcript: Human XM_011512148.2

PREDICTED: Homo sapiens ankyrin repeat domain 44 (ANKRD44), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD44 (91526)
Length:
9307
CDS:
184..3213

Additional Resources:

NCBI RefSeq record:
XM_011512148.2
NBCI Gene record:
ANKRD44 (91526)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512148.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422033 CAAGACGAGAGCCTTATTAAT pLKO_005 3025 CDS 100% 15.000 21.000 N ANKRD44 n/a
2 TRCN0000418172 AGAATGTGTGGAAGCGCTTAT pLKO_005 2076 CDS 100% 10.800 15.120 N ANKRD44 n/a
3 TRCN0000249194 TTTGTCAGGAGCTCGTGTAAA pLKO_005 366 CDS 100% 13.200 10.560 N Ankrd44 n/a
4 TRCN0000446806 GCACTATGCAGCTGCGAATTG pLKO_005 1563 CDS 100% 10.800 7.560 N ANKRD44 n/a
5 TRCN0000147456 GAGATCATTGAACTCCTGATT pLKO.1 346 CDS 100% 4.950 3.465 N ANKRD44 n/a
6 TRCN0000179911 CCAGCCAAACAATAATGGGTT pLKO.1 981 CDS 100% 2.640 1.848 N ANKRD44 n/a
7 TRCN0000147389 GCAGTAGCATATGGACATATT pLKO.1 2266 CDS 100% 0.000 0.000 N ANKRD44 n/a
8 TRCN0000146900 CTTTACATTTAGCTGCCCTAA pLKO.1 1307 CDS 100% 4.050 2.430 N ANKRD44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512148.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12961 pDONR223 100% 56.1% 55.1% None (many diffs) n/a
2 ccsbBroad304_12961 pLX_304 0% 56.1% 55.1% V5 (many diffs) n/a
3 TRCN0000474029 TACACCACAGTACGAAATTGCAGA pLX_317 27.3% 56.1% 55.1% V5 (many diffs) n/a
4 ccsbBroadEn_04548 pDONR223 100% 36.3% 36.3% None 1102_3027del n/a
5 ccsbBroad304_04548 pLX_304 0% 36.3% 36.3% V5 1102_3027del n/a
6 TRCN0000466077 GGCCGACCGACTCGATATCAATGA pLX_317 33.3% 36.3% 36.3% V5 1102_3027del n/a
Download CSV