Transcript: Human XM_011512213.2

PREDICTED: Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GCC2 (9648)
Length:
6793
CDS:
307..5025

Additional Resources:

NCBI RefSeq record:
XM_011512213.2
NBCI Gene record:
GCC2 (9648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512213.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147536 GAGAGCAGAGTTGATACTATT pLKO.1 2733 CDS 100% 13.200 9.240 N GCC2 n/a
2 TRCN0000147313 GCAAGAATTAGAGCTGGTTAA pLKO.1 3396 CDS 100% 10.800 7.560 N GCC2 n/a
3 TRCN0000099953 CCCTACAAGAAGAAATAACTT pLKO.1 3566 CDS 100% 5.625 3.375 N Gcc2 n/a
4 TRCN0000147782 GCTGACATGAAGAGTTTAGTT pLKO.1 6496 3UTR 100% 5.625 3.375 N GCC2 n/a
5 TRCN0000371194 ACCATACCAACTGGAATTTAG pLKO_005 5370 3UTR 100% 13.200 6.600 Y RGPD6 n/a
6 TRCN0000369313 ACGTCTTGCTGCAGTTCATTT pLKO_005 4832 CDS 100% 13.200 6.600 Y RGPD4 n/a
7 TRCN0000150103 CCAACTGGAATTTAGGCTTTA pLKO.1 5376 3UTR 100% 10.800 5.400 Y GCC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512213.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14023 pDONR223 100% 99.2% 99.1% None 0_1ins33;1393C>A;3064C>G n/a
2 ccsbBroad304_14023 pLX_304 0% 99.2% 99.1% V5 0_1ins33;1393C>A;3064C>G n/a
3 TRCN0000477870 CAGGGTCGGGCAAGAATTGAGACT pLX_317 12% 99.2% 99.1% V5 0_1ins33;1393C>A;3064C>G n/a
Download CSV