Transcript: Human XM_011512401.1

PREDICTED: Homo sapiens chloride voltage-gated channel 2 (CLCN2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLCN2 (1181)
Length:
3595
CDS:
125..2632

Additional Resources:

NCBI RefSeq record:
XM_011512401.1
NBCI Gene record:
CLCN2 (1181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512401.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418292 CCTTTGCTGTCATTGGTATTG pLKO_005 1092 CDS 100% 10.800 7.560 N CLCN2 n/a
2 TRCN0000419494 GGGTATCTATGAGAATGAATC pLKO_005 805 CDS 100% 10.800 7.560 N CLCN2 n/a
3 TRCN0000044905 CCTGGTCATCTTCATTCTCAT pLKO.1 1426 CDS 100% 4.950 3.465 N CLCN2 n/a
4 TRCN0000044906 GCAACTAGATGAACCTGTCAA pLKO.1 2455 CDS 100% 4.950 3.465 N CLCN2 n/a
5 TRCN0000044904 CATCACTTTCTCAGCCGGATT pLKO.1 556 CDS 100% 4.050 2.835 N CLCN2 n/a
6 TRCN0000044907 CCCTGAGATGAAGACCATCTT pLKO.1 616 CDS 100% 0.495 0.347 N CLCN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512401.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10736 pDONR223 100% 38% 35.3% None (many diffs) n/a
2 ccsbBroad304_10736 pLX_304 0% 38% 35.3% V5 (many diffs) n/a
3 TRCN0000470498 GCCGCGCAAACCTAATCCCCCCTC pLX_317 35.6% 38% 35.3% V5 (many diffs) n/a
4 TRCN0000489431 ATATAACCCGGTACCCCGACTGAA pLX_317 35.6% 38% 35.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV