Transcript: Human XM_011512955.1

PREDICTED: Homo sapiens prolyl 3-hydroxylase 2 (P3H2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
P3H2 (55214)
Length:
2973
CDS:
206..1789

Additional Resources:

NCBI RefSeq record:
XM_011512955.1
NBCI Gene record:
P3H2 (55214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064795 CCTCTGCACTATGATTACCTA pLKO.1 578 CDS 100% 3.000 4.200 N P3H2 n/a
2 TRCN0000291770 CCTCTGCACTATGATTACCTA pLKO_005 578 CDS 100% 3.000 4.200 N P3H2 n/a
3 TRCN0000064794 CCCAAGATAGATCGAGACCTA pLKO.1 959 CDS 100% 2.640 3.696 N P3H2 n/a
4 TRCN0000291773 CCCAAGATAGATCGAGACCTA pLKO_005 959 CDS 100% 2.640 3.696 N P3H2 n/a
5 TRCN0000064797 GCTGGTCTGTATGAAGCTATT pLKO.1 461 CDS 100% 10.800 7.560 N P3H2 n/a
6 TRCN0000291842 GCTGGTCTGTATGAAGCTATT pLKO_005 461 CDS 100% 10.800 7.560 N P3H2 n/a
7 TRCN0000064796 CCATGCTGACAACTGTTTGTT pLKO.1 1399 CDS 100% 5.625 3.938 N P3H2 n/a
8 TRCN0000291843 CCATGCTGACAACTGTTTGTT pLKO_005 1399 CDS 100% 5.625 3.938 N P3H2 n/a
9 TRCN0000064793 GCTTACACATTTCGAGACTAT pLKO.1 1457 CDS 100% 4.950 3.465 N P3H2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2240 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14190 pDONR223 100% 99.8% 99.2% None 153C>T;1566delC n/a
2 ccsbBroad304_14190 pLX_304 0% 99.8% 99.2% V5 (not translated due to frame shift) 153C>T;1566delC n/a
3 TRCN0000465861 ACCTATGGCCATGGACCGGCTGAA pLX_317 21.5% 99.8% 99.2% V5 (not translated due to frame shift) 153C>T;1566delC n/a
Download CSV