Transcript: Human XM_011513141.1

PREDICTED: Homo sapiens transducin beta like 1 X-linked receptor 1 (TBL1XR1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBL1XR1 (79718)
Length:
6559
CDS:
271..1815

Additional Resources:

NCBI RefSeq record:
XM_011513141.1
NBCI Gene record:
TBL1XR1 (79718)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060745 GCAGCATAAAGGCCCTATATT pLKO.1 1059 CDS 100% 15.000 21.000 N TBL1XR1 n/a
2 TRCN0000060747 CGCTGCATTGATTTCTATCAT pLKO.1 408 CDS 100% 5.625 7.875 N TBL1XR1 n/a
3 TRCN0000344878 AGCAGACACCATGGATTATAT pLKO_005 2179 3UTR 100% 15.000 10.500 N TBL1XR1 n/a
4 TRCN0000344934 CAGCATAAAGGCCCTATATTT pLKO_005 1060 CDS 100% 15.000 10.500 N TBL1XR1 n/a
5 TRCN0000353100 GGACAAGACAGACCTATTAAA pLKO_005 1279 CDS 100% 15.000 10.500 N TBL1XR1 n/a
6 TRCN0000344933 TGTATTAGACCTTCGGAAATA pLKO_005 1794 CDS 100% 13.200 9.240 N TBL1XR1 n/a
7 TRCN0000060743 CCAGGGACTAATAATCCAAAT pLKO.1 1480 CDS 100% 10.800 7.560 N TBL1XR1 n/a
8 TRCN0000333667 CCAGGGACTAATAATCCAAAT pLKO_005 1480 CDS 100% 10.800 7.560 N TBL1XR1 n/a
9 TRCN0000060746 GCACCAGCATTGGATGTTGAT pLKO.1 1195 CDS 100% 4.950 3.465 N TBL1XR1 n/a
10 TRCN0000109340 GCATGAAGTAAGGGAGTGAAT pLKO.1 2317 3UTR 100% 4.950 3.465 N Tbl1xr1 n/a
11 TRCN0000317949 GCATGAAGTAAGGGAGTGAAT pLKO_005 2317 3UTR 100% 4.950 3.465 N Tbl1xr1 n/a
12 TRCN0000060744 CCTTTGGTATAGAAAGCCATA pLKO.1 350 CDS 100% 4.050 2.835 N TBL1XR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08951 pDONR223 100% 99.8% 99.8% None 1311C>T;1535T>C n/a
2 ccsbBroad304_08951 pLX_304 43.1% 99.8% 99.8% V5 1311C>T;1535T>C n/a
3 TRCN0000480332 GGCCGACAAGGCAACTCACGGAAA pLX_317 29.2% 99.8% 99.8% V5 1311C>T;1535T>C n/a
Download CSV