Transcript: Human XM_011513318.2

PREDICTED: Homo sapiens transmembrane protein 44 (TMEM44), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM44 (93109)
Length:
2380
CDS:
101..1537

Additional Resources:

NCBI RefSeq record:
XM_011513318.2
NBCI Gene record:
TMEM44 (93109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140535 GCACTGGACCTCGCTATTATT pLKO.1 1019 CDS 100% 15.000 21.000 N TMEM44 n/a
2 TRCN0000142945 CCTAGCAGCTATTGACTTAGT pLKO.1 391 CDS 100% 4.950 3.465 N TMEM44 n/a
3 TRCN0000139163 CTGCAAGTCACTGAGGACAAT pLKO.1 1198 CDS 100% 4.950 3.465 N TMEM44 n/a
4 TRCN0000140613 GACAGCAATCAGTCGCTACAT pLKO.1 1219 CDS 100% 4.950 3.465 N TMEM44 n/a
5 TRCN0000143353 GTGTGTGATGAAGAGCAAGAT pLKO.1 1048 CDS 100% 4.950 3.465 N TMEM44 n/a
6 TRCN0000140460 GAAGACATTTCCCTCCATCCA pLKO.1 871 CDS 100% 2.640 1.848 N TMEM44 n/a
7 TRCN0000140715 GACAGCTCACAATCCAGGTTT pLKO.1 357 CDS 100% 4.950 2.475 Y TMEM44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16069 pDONR223 0% 75.1% 58.5% None (many diffs) n/a
2 ccsbBroad304_16069 pLX_304 0% 75.1% 58.5% V5 (many diffs) n/a
3 ccsbBroadEn_12991 pDONR223 100% 32.7% 32.7% None 1_954del;1324_1325ins33 n/a
4 ccsbBroad304_12991 pLX_304 0% 32.7% 32.7% V5 1_954del;1324_1325ins33 n/a
5 TRCN0000469850 CGTCTCGAGCCATGAACCATGAGG pLX_317 11.6% 32.7% 32.7% V5 1_954del;1324_1325ins33 n/a
Download CSV