Transcript: Human XM_011513504.2

PREDICTED: Homo sapiens serine/threonine kinase 32B (STK32B), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STK32B (55351)
Length:
4219
CDS:
1649..2308

Additional Resources:

NCBI RefSeq record:
XM_011513504.2
NBCI Gene record:
STK32B (55351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194905 CCATGTCATCTCTTAGATTTC pLKO.1 3825 3UTR 100% 10.800 15.120 N STK32B n/a
2 TRCN0000342550 CCATGTCATCTCTTAGATTTC pLKO_005 3825 3UTR 100% 10.800 15.120 N STK32B n/a
3 TRCN0000002275 GATCCCACATTTGAGCTTGAA pLKO.1 1991 CDS 100% 4.950 6.930 N STK32B n/a
4 TRCN0000199069 CGTGCCCTACTTGGCCGACAT pLKO.1 1900 CDS 100% 0.000 0.000 N STK32B n/a
5 TRCN0000195456 CGAGACTATTTCTGGATTGTG pLKO.1 3928 3UTR 100% 4.950 3.465 N STK32B n/a
6 TRCN0000197258 GAAGTATTCCAGGTGTACATG pLKO.1 1631 5UTR 100% 4.950 3.465 N STK32B n/a
7 TRCN0000002273 CCAAAGCAATCAAACCGTCAT pLKO.1 2685 3UTR 100% 4.050 2.835 N STK32B n/a
8 TRCN0000196489 GAGATGATTCTAGAATCCAAG pLKO.1 2012 CDS 100% 4.050 2.835 N STK32B n/a
9 TRCN0000342601 GAGATGATTCTAGAATCCAAG pLKO_005 2012 CDS 100% 4.050 2.835 N STK32B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08529 pDONR223 100% 52.8% 52.6% None 0_1ins585;7A>G n/a
2 ccsbBroad304_08529 pLX_304 0% 52.8% 52.6% V5 0_1ins585;7A>G n/a
3 ccsbBroadEn_15096 pDONR223 0% 52.8% 52.6% None 0_1ins585;7A>G n/a
4 ccsbBroad304_15096 pLX_304 0% 52.8% 52.6% V5 0_1ins585;7A>G n/a
5 TRCN0000491984 CTTCATGATGTGTCTAATTTGTTC pLX_317 24.5% 52.7% 30.5% V5 (not translated due to prior stop codon) 0_1ins585;7A>G;370_371insT n/a
Download CSV