Transcript: Human XM_011513819.2

PREDICTED: Homo sapiens SEL1L family member 3 (SEL1L3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEL1L3 (23231)
Length:
5991
CDS:
190..3501

Additional Resources:

NCBI RefSeq record:
XM_011513819.2
NBCI Gene record:
SEL1L3 (23231)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513819.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161585 GAACGCCCTTTCAAAGATCAT pLKO.1 823 CDS 100% 4.950 6.930 N SEL1L3 n/a
2 TRCN0000187272 CGCCTGGATTACTCACAAATA pLKO.1 711 CDS 100% 13.200 9.240 N SEL1L3 n/a
3 TRCN0000161039 GCTACCACAATCAGACCATTA pLKO.1 1325 CDS 100% 10.800 7.560 N SEL1L3 n/a
4 TRCN0000204183 GCCAGATAGTAGTAACCACTA pLKO.1 1283 CDS 100% 4.050 2.835 N SEL1L3 n/a
5 TRCN0000159090 GCTGAGGTTCAAGAAATAGTA pLKO.1 1543 CDS 100% 5.625 3.375 N SEL1L3 n/a
6 TRCN0000434454 AGACCAACCTGGGCAACATAG pLKO_005 5036 3UTR 100% 10.800 5.400 Y SULT1A1 n/a
7 TRCN0000173087 CAGATGAGGAAACTGAGGCTT pLKO.1 4891 3UTR 100% 2.640 1.320 Y FLJ45966 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513819.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11701 pDONR223 100% 83.1% 82% None (many diffs) n/a
2 ccsbBroad304_11701 pLX_304 0% 83.1% 82% V5 (many diffs) n/a
3 TRCN0000479888 TTGTCTTGTGTTTTTGCACATTTA pLX_317 13.8% 83.1% 82% V5 (many diffs) n/a
Download CSV