Transcript: Human XM_011513957.2

PREDICTED: Homo sapiens UDP glycosyltransferase family 3 member A1 (UGT3A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UGT3A1 (133688)
Length:
2607
CDS:
16..1494

Additional Resources:

NCBI RefSeq record:
XM_011513957.2
NBCI Gene record:
UGT3A1 (133688)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150035 CACACTGACACTTACAATGAA pLKO.1 1176 CDS 100% 5.625 4.500 N UGT3A1 n/a
2 TRCN0000150012 CCCTTGTAAAGCTAATGGAAA pLKO.1 248 CDS 100% 4.950 3.960 N UGT3A1 n/a
3 TRCN0000422725 ATATCTTGCCCTTCCTATAAG pLKO_005 1901 3UTR 100% 13.200 9.240 N UGT3A1 n/a
4 TRCN0000435337 TGGGACATGCAGTCTACATTT pLKO_005 565 CDS 100% 13.200 9.240 N UGT3A1 n/a
5 TRCN0000418884 AGTACCTCATTGATGTCTTTG pLKO_005 1370 CDS 100% 10.800 7.560 N UGT3A1 n/a
6 TRCN0000423257 TGGTGGGCAGAACAGCGTAAT pLKO_005 1029 CDS 100% 10.800 7.560 N UGT3A1 n/a
7 TRCN0000179728 GCAGTACCTCATTGATGTCTT pLKO.1 1368 CDS 100% 4.950 3.465 N UGT3A1 n/a
8 TRCN0000147673 GATGTTCATTTGGCCACAAAT pLKO.1 937 CDS 100% 1.320 0.924 N UGT3A1 n/a
9 TRCN0000150098 CCTTGTCTTATGTTCCAGTAT pLKO.1 461 CDS 100% 4.950 2.475 Y UGT3A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04885 pDONR223 100% 90.5% 85.6% None (many diffs) n/a
2 ccsbBroad304_04885 pLX_304 0% 90.5% 85.6% V5 (many diffs) n/a
3 TRCN0000471431 GCAGTGCGTTCTTTAACGATTGAA pLX_317 28.1% 90.5% 85.6% V5 (many diffs) n/a
4 ccsbBroadEn_09550 pDONR223 100% 49% 44.1% None (many diffs) n/a
5 ccsbBroad304_09550 pLX_304 0% 49% 44.1% V5 (many diffs) n/a
6 TRCN0000468419 ATCCGTGTCATGTACCAAGTCGTT pLX_317 60.8% 49% 44.1% V5 (many diffs) n/a
Download CSV