Construct: ORF TRCN0000476668
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000873.1_s317c1
- Derived from:
- ccsbBroadEn_14719
- DNA Barcode:
- CGTGTTGAAGCGCTGCGCAGTTTG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- NPR3 (4883)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476668
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001204375.2 | 99.6% | 4.4% | (many diffs) |
2 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_000908.4 | 99.5% | 4.4% | (many diffs) |
3 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | XM_017009492.2 | 92.1% | 4.7% | (many diffs) |
4 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001363652.2 | 58.4% | 1.9% | (many diffs) |
5 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001204376.1 | 58.3% | 1.9% | (many diffs) |
6 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | XM_011514047.2 | 57.1% | .5% | (many diffs) |
7 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001364458.2 | 54.2% | .8% | (many diffs) |
8 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | XM_011514049.3 | 52% | 2.6% | 0_1ins778;34_34delAinsTC |
9 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001364460.2 | 50.7% | 2.1% | (many diffs) |
10 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | XM_011514050.2 | 48.6% | 8.7% | (many diffs) |
11 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | NM_008728.2 | 86.2% | 2.8% | (many diffs) |
12 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | NM_001039181.1 | 86% | 2.8% | (many diffs) |
13 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | XM_006520028.2 | 46.5% | .5% | (many diffs) |
14 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | XM_006520030.3 | 46.5% | .5% | (many diffs) |
15 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | XM_006520031.2 | 46.5% | .5% | (many diffs) |
16 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | XM_017316493.1 | 46.5% | .5% | (many diffs) |
17 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | NM_001286395.1 | 46.4% | .5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 255
- ORF length:
- 186
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gccgtctctg ctggtggcgc acattctccc cgtgcgtact actcggctgg 121 gcgttgctgg ccggcggcac cggtggcggt ggcgttggcg gcggcggcgg tggcgcgggc 181 ataggcggcg gacgccagga gagagaggcg ctgccgccac agaagatcga ggtgctggtg 241 ttactgcccc aggatgactc gtacttgttt tcactcaccc gggtgcggcc ggccatcgag 301 tatgctctgc gcagcgtgga gggcaacggg actgggaggc ggcttctgcc gccgggcact 361 cgcttccagg tggcttacga ggattcagac tgtgggaacc gtgcgctctt cagcttggtg 421 gaccgcgtgg cggcggcgcg gggcgccaag ccagacctta tcctggggcc agtgtgcgag 481 tatgcagcag cgccagtggc ccggcttgca tcgcactggg acctgcccat gctgtcggct 541 ggggcgctgg ccgctggctt ccagcacaag gactctgagt actcgcacct cacgcgcgtg 601 gcgcccgcct acgccaagat gggcgagatg atgctcgccc tgttccgcca ccaccactgg 661 agccgcgctg cactggtcta cagcgacgac aagctggagc ggaactgcta cttcaccctc 721 gagggggtcc acgaggtctt ccaggaggag ggtttgcaca cgtccatcta cagtttcgac 781 gagaccaaag acttggatct ggaagacatc gtgcgcaata tccaggccag tgagagagtg 841 gtgatcatgt gtgcgagcag tgacaccatc cggagcatct ctgctggtgg cgcacaggca 901 tggcatgacc agtggagact acgccttctt caacattgag ctcttcaaca gctcttccta 961 tggagatggc tcatggaaga gaggagacaa acacgacttt gaagctaagc aagcatactc 1021 gtccctccag acagtcactc tactgaggac agtgaaacct gagtttgaga agttttccat 1081 ggaggtgaaa agttcagttg agaaacaagg gctcaatatg gaggattacg ttaacatgtt 1141 tgttgaagga ttccacgatg ccatcctcct ctacgtcttg gctctacatg aagtactcag 1201 agctggttac agcaaaaagg atggagggaa aattatacag cagacttgga acagaaCATT 1261 TGAAGGTATC GCCGGGCAGG TGTCCATAGA TGCCAACGGA GACCGATATG GGGATTTCTC 1321 TGTGATTGCC ATGACTGATG TGGAGGCGGG CACCCAGGAG GTTATTGGTG ATTATTTTGG 1381 AAAAGAAGGT CGTTTTGAAA TGCGGCCGAA TGTCAAATAT CCTTGGGGCC CTTTAAAACT 1441 GAGAATAGAT GAAAACCGAA TTGTAGAGCA TACAAACAGC TCTCCCTGCA AATCATCAGG 1501 TGGCCTAGAA GAATCGGCAG TGACAGGAAT TGTCGTGGGG GCTTTACTAG GAGCTGGCTT 1561 GCTAATGGCC TTCTACTTTT TCAGGAAGAA ATACAGAATA ACCATTGAGA GGCGAACCCA 1621 GCAAGAAGAA AGTAACCTTG GAAAACATCG GGAATTACGG GAAGATTCCA TCAGATCCCA 1681 TTTTTCAGTA GCTTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC 1741 TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT 1801 TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC GTGTTGAAGC GCTGCGCAGT 1861 TTGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag att