Construct: ORF TRCN0000488510
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019235.1_s317c1
- DNA Barcode:
- AAGGGAAACGTAGGGATGCTCTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NPR3 (4883)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488510
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001204375.2 | 100% | 100% | |
| 2 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_000908.4 | 99.8% | 99.6% | 1426_1427insCAG |
| 3 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | XM_017009492.2 | 92.4% | 92.4% | 768_769ins123 |
| 4 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001363652.2 | 58.6% | 52.8% | (many diffs) |
| 5 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001204376.1 | 58.4% | 52.4% | (many diffs) |
| 6 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | XM_011514047.2 | 57.2% | 53.3% | (many diffs) |
| 7 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001364458.2 | 54.4% | 53% | (many diffs) |
| 8 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | XM_011514049.3 | 52.1% | 52.1% | 0_1ins777 |
| 9 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | NM_001364460.2 | 50.8% | 43.1% | (many diffs) |
| 10 | human | 4883 | NPR3 | natriuretic peptide receptor 3 | XM_011514050.2 | 49.3% | 47.3% | (many diffs) |
| 11 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | NM_008728.2 | 86.5% | 90.7% | (many diffs) |
| 12 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | NM_001039181.1 | 86.3% | 90.3% | (many diffs) |
| 13 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | XM_006520028.2 | 46.7% | 49.3% | (many diffs) |
| 14 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | XM_006520030.3 | 46.7% | 49.3% | (many diffs) |
| 15 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | XM_006520031.2 | 46.7% | 49.3% | (many diffs) |
| 16 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | XM_017316493.1 | 46.7% | 49.3% | (many diffs) |
| 17 | mouse | 18162 | Npr3 | natriuretic peptide receptor 3 | NM_001286395.1 | 46.5% | 48.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1698
- ORF length:
- 1623
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgccg tctctgctgg tgctcacttt ctccccgtgc gtactactcg 121 gctgggcgtt gctggccggc ggcaccggtg gcggtggcgt tggcggcggc ggcggtggcg 181 cgggcatagg cggcggacgc caggagagag aggcgctgcc gccacagaag atcgaggtgc 241 tggtgttact gccccaggat gactcgtact tgttttcact cacccgggtg cggccggcca 301 tcgagtatgc tctgcgcagc gtggagggca acgggactgg gaggcggctt ctgccgccgg 361 gcactcgctt ccaggtggct tacgaggatt cagactgtgg gaaccgtgcg ctcttcagct 421 tggtggaccg cgtggcggcg gcgcggggcg ccaagccaga ccttatcctg gggccagtgt 481 gcgagtatgc agcagcgcca gtggcccggc ttgcatcgca ctgggacctg cccatgctgt 541 cggctggggc gctggccgct ggcttccagc acaaggactc tgagtactcg cacctcacgc 601 gcgtggcgcc cgcctacgcc aagatgggcg agatgatgct cgccctgttc cgccaccacc 661 actggagccg cgctgcactg gtctacagcg acgacaagct ggagcggaac tgctacttca 721 ccctcgaggg ggtccacgag gtcttccagg aggagggttt gcacacgtcc atctacagtt 781 tcgacgagac caaagacttg gatctggaag acatcgtgcg caatatccag gccagtgaga 841 gagtggtgat catgtgtgcg agcagtgaca ccatccggag catcatgctg gtggcgcaca 901 ggcatggcat gaccagtgga gactacgcct tcttcaacat tgagctcttc aacagctctt 961 cctatggaga tggctcatgg aagagaggag acaaacacga ctttgaagct aagcaagcat 1021 actcgtccct ccagacagtc actctactga ggacagtgaa acctgagttt gagaagtttt 1081 ccatggaggt gaaaagttca gttgagaaac aagggctcaa tatggaggat tacgttaaca 1141 tgtttgttga aggattccac gatgccatcc tcctctacgt cttggctcta catgaagtac 1201 tcagagctgg ttacagcaaa aaggatggag ggaaaattat acagcagact tggaacagaa 1261 catttgaagg tatcgccggg caggtgtcca tagatgccaa cggagaccga tatggggatt 1321 tcTCTGTGAT TGCCATGACT GATGTGGAGG CGGGCACCCA GGAGGTTATT GGTGATTATT 1381 TTGGAAAAGA AGGTCGTTTT GAAATGCGGC CGAATGTCAA ATATCCTTGG GGCCCTTTAA 1441 AACTGAGAAT AGATGAAAAC CGAATTGTAG AGCATACAAA CAGCTCTCCC TGCAAATCAT 1501 CAGGTGGCCT AGAAGAATCG GCAGTGACAG GAATTGTCGT GGGGGCTTTA CTAGGAGCTG 1561 GCTTGCTAAT GGCCTTCTAC TTTTTCAGGA AGAAATACAG AATAACCATT GAGAGGCGAA 1621 CCCAGCAAGA AGAAAGTAAC CTTGGAAAAC ATCGGGAATT ACGGGAAGAT TCCATCAGAT 1681 CCCATTTTTC AGTAGCTGAC CCAGCTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1741 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1801 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAAAGGGAA ACGTAGGGAT 1861 GCTCTCTACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt