Transcript: Human XM_011514357.3

PREDICTED: Homo sapiens kinesin family member 6 (KIF6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF6 (221458)
Length:
2598
CDS:
96..2573

Additional Resources:

NCBI RefSeq record:
XM_011514357.3
NBCI Gene record:
KIF6 (221458)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514357.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432891 AGGAATCTTGATGAGTCTATA pLKO_005 1074 CDS 100% 13.200 10.560 N KIF6 n/a
2 TRCN0000116579 CCTAGCTTGGAAATCATCTTA pLKO.1 195 CDS 100% 5.625 4.500 N KIF6 n/a
3 TRCN0000422510 ACAGCGAGTGGCACTCATAAA pLKO_005 1112 CDS 100% 13.200 9.240 N KIF6 n/a
4 TRCN0000413671 TCTAACAGAGGCCAAGTATAT pLKO_005 893 CDS 100% 13.200 9.240 N KIF6 n/a
5 TRCN0000116580 GTGAAGCTACAGAAAGAGTTT pLKO.1 2121 CDS 100% 4.950 3.465 N KIF6 n/a
6 TRCN0000116578 CGAAATCAATATCCTGGTCAA pLKO.1 1514 CDS 100% 4.050 2.835 N KIF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514357.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13426 pDONR223 100% 87.1% 86.2% None (many diffs) n/a
2 ccsbBroad304_13426 pLX_304 0% 87.1% 86.2% V5 (many diffs) n/a
3 TRCN0000468540 CAAGGGTATGTCCTGTGCAACCAA pLX_317 17.7% 87.1% 86.2% V5 (many diffs) n/a
4 ccsbBroadEn_13425 pDONR223 100% 29% 28.9% None (many diffs) n/a
5 ccsbBroad304_13425 pLX_304 0% 29% 28.9% V5 (many diffs) n/a
6 TRCN0000469908 GAGCAACTTGATGCCACGTCACTG pLX_317 38.8% 29% 28.9% V5 (many diffs) n/a
Download CSV