Transcript: Human XM_011514768.1

PREDICTED: Homo sapiens copine 5 (CPNE5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPNE5 (57699)
Length:
2136
CDS:
68..2080

Additional Resources:

NCBI RefSeq record:
XM_011514768.1
NBCI Gene record:
CPNE5 (57699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514768.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157659 GTCATCGACAACACGCTCAAT pLKO.1 266 CDS 100% 4.950 6.930 N CPNE5 n/a
2 TRCN0000151165 GTCATGAAGAACACCCTAAAT pLKO.1 776 CDS 100% 13.200 10.560 N CPNE5 n/a
3 TRCN0000150992 CAACATCTATGAGGTGGTAAA pLKO.1 961 CDS 100% 10.800 7.560 N CPNE5 n/a
4 TRCN0000151674 GCAAGTTCATTGTGGATTACT pLKO.1 300 CDS 100% 5.625 3.938 N CPNE5 n/a
5 TRCN0000151871 CCTGATTTATCCAAACACGAT pLKO.1 377 CDS 100% 2.640 1.848 N CPNE5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514768.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12396 pDONR223 100% 40.9% 36.3% None (many diffs) n/a
2 ccsbBroad304_12396 pLX_304 0% 40.9% 36.3% V5 (many diffs) n/a
3 TRCN0000470806 GGGTAGCATGCGGCTCGGCCTCGC pLX_317 51.7% 40.9% 36.3% V5 (many diffs) n/a
Download CSV