Transcript: Human XM_011514952.2

PREDICTED: Homo sapiens SPT3 homolog, SAGA and STAGA complex component (SUPT3H), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUPT3H (8464)
Length:
3433
CDS:
1332..2291

Additional Resources:

NCBI RefSeq record:
XM_011514952.2
NBCI Gene record:
SUPT3H (8464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013208 CCCAATGTTGTCGCAATGGAA pLKO.1 1968 CDS 100% 3.000 4.200 N SUPT3H n/a
2 TRCN0000421978 TCTGTGAAAGTCGACAATTAA pLKO_005 1885 CDS 100% 15.000 10.500 N SUPT3H n/a
3 TRCN0000421842 ATGTTTGAAGATGACGAAATT pLKO_005 1788 CDS 100% 13.200 9.240 N SUPT3H n/a
4 TRCN0000413900 CAGAGTATGATGTATTCTTTA pLKO_005 1422 CDS 100% 13.200 9.240 N SUPT3H n/a
5 TRCN0000434657 GAGTACAGGGAAGTCTATAAG pLKO_005 1385 CDS 100% 13.200 9.240 N SUPT3H n/a
6 TRCN0000424565 AGCATATTTAGCGTATGAAAC pLKO_005 1994 CDS 100% 10.800 7.560 N SUPT3H n/a
7 TRCN0000415120 TAGAAGGCCTCTTCATGAAAC pLKO_005 1451 CDS 100% 10.800 7.560 N SUPT3H n/a
8 TRCN0000013210 CCGAGACTACAAATCAAAGAT pLKO.1 1640 CDS 100% 5.625 3.938 N SUPT3H n/a
9 TRCN0000013211 GATGTGGTACACACTCAGTTA pLKO.1 1488 CDS 100% 4.950 3.465 N SUPT3H n/a
10 TRCN0000013209 CGAATTATGGATTCAGCTCAA pLKO.1 1854 CDS 100% 4.050 2.835 N SUPT3H n/a
11 TRCN0000013212 GCCACAGGATTGGCCCACTTT pLKO.1 2212 CDS 100% 1.650 1.155 N SUPT3H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13993 pDONR223 100% 87.6% 77% None (many diffs) n/a
2 ccsbBroad304_13993 pLX_304 0% 87.6% 77% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000475333 CGGCCAAAGCTTCGAAATTAGGCC pLX_317 56.8% 87.6% 77% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV