Transcript: Human XM_011515007.1

PREDICTED: Homo sapiens RHO family interacting cell polarization regulator 2 (RIPOR2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIPOR2 (9750)
Length:
6113
CDS:
881..4024

Additional Resources:

NCBI RefSeq record:
XM_011515007.1
NBCI Gene record:
RIPOR2 (9750)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515007.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415672 GACGCCTGGAGTTTCATATAA pLKO_005 1356 CDS 100% 15.000 21.000 N RIPOR2 n/a
2 TRCN0000428396 GACCTAGACAAGCAAATTAAA pLKO_005 1316 CDS 100% 15.000 10.500 N RIPOR2 n/a
3 TRCN0000412409 GAACCAAGAAGTCATGAATTT pLKO_005 2701 CDS 100% 13.200 9.240 N RIPOR2 n/a
4 TRCN0000433044 TGAACTCTATGAAGCTTATTG pLKO_005 1387 CDS 100% 13.200 9.240 N RIPOR2 n/a
5 TRCN0000155019 GCAGATCCTTTCTAGATGGAA pLKO.1 2604 CDS 100% 3.000 2.100 N RIPOR2 n/a
6 TRCN0000434454 AGACCAACCTGGGCAACATAG pLKO_005 4227 3UTR 100% 10.800 5.400 Y SULT1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515007.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467274 GGGGGAGTGATTCTGGCAACTAAG pLX_317 24.3% 56.4% 56.3% V5 1_87del;1858_1860delTGC;1864_3141del n/a
2 ccsbBroadEn_07481 pDONR223 100% 56.4% 56.2% None (many diffs) n/a
3 ccsbBroad304_07481 pLX_304 0% 56.4% 56.2% V5 (many diffs) n/a
Download CSV