Transcript: Human XM_011515737.2

PREDICTED: Homo sapiens family with sequence similarity 3 member C (FAM3C), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM3C (10447)
Length:
2634
CDS:
341..1024

Additional Resources:

NCBI RefSeq record:
XM_011515737.2
NBCI Gene record:
FAM3C (10447)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293815 CTTGGTGTGTGCATGAGTATT pLKO_005 1125 3UTR 100% 13.200 9.240 N FAM3C n/a
2 TRCN0000298584 GAGGAGATGTGGCACCATTTA pLKO_005 717 CDS 100% 13.200 9.240 N FAM3C n/a
3 TRCN0000115958 GCCATACAAGATGGAACAATA pLKO.1 752 CDS 100% 13.200 9.240 N FAM3C n/a
4 TRCN0000286431 GCCATACAAGATGGAACAATA pLKO_005 752 CDS 100% 13.200 9.240 N FAM3C n/a
5 TRCN0000293814 GGGAGCACATCTATTACTAAT pLKO_005 845 CDS 100% 13.200 9.240 N FAM3C n/a
6 TRCN0000298583 ATGTTGGAAGAGGGATCAATG pLKO_005 636 CDS 100% 10.800 7.560 N FAM3C n/a
7 TRCN0000191798 GAACAGCACATAAAGAACAAT pLKO.1 929 CDS 100% 5.625 3.938 N Fam3c n/a
8 TRCN0000292737 GAACAGCACATAAAGAACAAT pLKO_005 929 CDS 100% 5.625 3.938 N Fam3c n/a
9 TRCN0000115959 GATGCAAGTTTAGGAAATCTA pLKO.1 434 CDS 100% 5.625 3.938 N FAM3C n/a
10 TRCN0000191797 GATGCAAGTTTAGGAAATCTA pLKO.1 434 CDS 100% 5.625 3.938 N Fam3c n/a
11 TRCN0000292666 GATGCAAGTTTAGGAAATCTA pLKO_005 434 CDS 100% 5.625 3.938 N Fam3c n/a
12 TRCN0000115961 AGGAGAAGTATTAGACACTAA pLKO.1 679 CDS 100% 4.950 3.465 N FAM3C n/a
13 TRCN0000115957 CCTGTGTTTATCTAACTTCAT pLKO.1 1940 3UTR 100% 4.950 3.465 N FAM3C n/a
14 TRCN0000115960 CCAGATATAAGTGTGGGATCT pLKO.1 501 CDS 100% 4.050 2.835 N FAM3C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02438 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02438 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472626 TGTCGGAAGTACAACGGTAACAGG pLX_317 71% 100% 100% V5 n/a
Download CSV