Transcript: Human XM_011516457.2

PREDICTED: Homo sapiens Ras homolog, mTORC1 binding (RHEB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHEB (6009)
Length:
2124
CDS:
496..1017

Additional Resources:

NCBI RefSeq record:
XM_011516457.2
NBCI Gene record:
RHEB (6009)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039598 CCCTCCCTTCAGATTATGTTA pLKO.1 1149 3UTR 100% 5.625 7.875 N RHEB n/a
2 TRCN0000039600 CAAGTCTTCATGCTCGGTGAT pLKO.1 993 CDS 100% 4.050 5.670 N RHEB n/a
3 TRCN0000010425 TTATGTTGGTTGGGAATAAGA pLKO.1 803 CDS 100% 5.625 3.375 N RHEB n/a
4 TRCN0000039599 CCTATTATGTTGGTTGGGAAT pLKO.1 799 CDS 100% 4.050 2.430 N RHEB n/a
5 TRCN0000009865 TATCATCTTCAACTTGTAGAC pLKO.1 622 CDS 100% 4.050 2.430 N RHEB n/a
6 TRCN0000415710 ATGGAAAGGGTGATCAGTTAT pLKO_005 835 CDS 100% 13.200 6.600 Y RHEB n/a
7 TRCN0000435736 CAAAGTTGATCACAGTAAATG pLKO_005 593 CDS 100% 13.200 6.600 Y RHEB n/a
8 TRCN0000436662 CAATTTGTTGAAGGCCAATTT pLKO_005 535 CDS 100% 13.200 6.600 Y RHEB n/a
9 TRCN0000075605 CAGACATACTCCATAGATATT pLKO.1 676 CDS 100% 13.200 6.600 Y Rheb n/a
10 TRCN0000039602 CCGGGCAAGATGAATATTCTA pLKO.1 647 CDS 100% 5.625 2.813 Y RHEB n/a
11 TRCN0000039601 CCTACGATCCAACCATAGAAA pLKO.1 563 CDS 100% 5.625 2.813 Y RHEB n/a
12 TRCN0000010424 CCTCAGACATACTCCATAGAT pLKO.1 673 CDS 100% 5.625 2.813 Y RHEB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01398 pDONR223 100% 91.5% 91.3% None (many diffs) n/a
2 ccsbBroad304_01398 pLX_304 98.4% 91.5% 91.3% V5 (many diffs) n/a
3 TRCN0000468386 ATTCCCATCTACATCCAGAAAAAC pLX_317 61.3% 91.5% 91.3% V5 (many diffs) n/a
4 ccsbBroadEn_06864 pDONR223 100% 91.3% 90.7% None (many diffs) n/a
5 ccsbBroad304_06864 pLX_304 98.4% 91.3% 90.7% V5 (many diffs) n/a
6 TRCN0000475474 AGGTGTTTCACCGGGTTTCGAGCT pLX_317 49.6% 91.3% 90.7% V5 (many diffs) n/a
Download CSV