Transcript: Human XM_011516947.3

PREDICTED: Homo sapiens zinc finger protein, FOG family member 2 (ZFPM2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFPM2 (23414)
Length:
11424
CDS:
7350..10775

Additional Resources:

NCBI RefSeq record:
XM_011516947.3
NBCI Gene record:
ZFPM2 (23414)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516947.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020266 GCCCACAGCTATTGTCAATAA pLKO.1 8039 CDS 100% 13.200 10.560 N ZFPM2 n/a
2 TRCN0000416292 CAAGCTGCCTTCCGATGTAAT pLKO_005 8397 CDS 100% 13.200 9.240 N ZFPM2 n/a
3 TRCN0000427269 CCAGACTCAGAGGGAGTTATT pLKO_005 8435 CDS 100% 13.200 9.240 N ZFPM2 n/a
4 TRCN0000020268 CCACAGAATTTGGGCCTGAAA pLKO.1 7459 CDS 100% 4.950 3.465 N ZFPM2 n/a
5 TRCN0000020265 CCACAGACTTATTGACCAGAA pLKO.1 8551 CDS 100% 4.050 2.835 N ZFPM2 n/a
6 TRCN0000020267 CGAAACATACATGGTCCACAA pLKO.1 9416 CDS 100% 4.050 2.835 N ZFPM2 n/a
7 TRCN0000020264 GCTACGAAAGAAGCATAATAA pLKO.1 10042 CDS 100% 15.000 9.000 N ZFPM2 n/a
8 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3510 5UTR 100% 4.950 2.475 Y ORAI2 n/a
9 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 7052 5UTR 100% 4.950 2.475 Y CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516947.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000468757 CAAGGTTGCAACAGACTCTACTTT pLX_317 12% 98.8% 98.7% V5 (many diffs) n/a
Download CSV