Transcript: Human XM_011516968.2

PREDICTED: Homo sapiens argonaute RISC catalytic component 2 (AGO2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGO2 (27161)
Length:
14658
CDS:
16..2772

Additional Resources:

NCBI RefSeq record:
XM_011516968.2
NBCI Gene record:
AGO2 (27161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516968.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432648 CTATGAACTCAGGGCTTTAAA pLKO_005 3063 3UTR 100% 15.000 21.000 N AGO2 n/a
2 TRCN0000433340 ATCGAACATGAGACGTCATTG pLKO_005 2868 3UTR 100% 10.800 15.120 N AGO2 n/a
3 TRCN0000007866 CAATCAAATTACAGGCCAATT pLKO.1 302 CDS 100% 10.800 15.120 N AGO2 n/a
4 TRCN0000007865 CGTCCGTGAATTTGGAATCAT pLKO.1 1371 CDS 100% 5.625 7.875 N AGO2 n/a
5 TRCN0000433524 ACAGATTCCCAAAGGGTAAAG pLKO_005 943 CDS 100% 10.800 7.560 N AGO2 n/a
6 TRCN0000009632 CAAAGGGTAAAGTTTACCAAA pLKO.1 952 CDS 100% 4.950 3.465 N Ago2 n/a
7 TRCN0000007864 CGGCAAGAAGAGATTAGCAAA pLKO.1 1315 CDS 100% 4.950 3.465 N AGO2 n/a
8 TRCN0000007867 GCACAGCCAGTAATCGAGTTT pLKO.1 871 CDS 100% 4.950 3.465 N AGO2 n/a
9 TRCN0000011203 CCAGATTTCAAACTTGGATTT pLKO.1 2928 3UTR 100% 10.800 6.480 N AGO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516968.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11851 pDONR223 100% 63.6% 63.7% None (many diffs) n/a
2 ccsbBroad304_11851 pLX_304 0% 63.6% 63.7% V5 (many diffs) n/a
3 TRCN0000468477 CTGAAGCTCCACCCAAAAACGCGC pLX_317 14.7% 63.6% 63.7% V5 (many diffs) n/a
4 ccsbBroadEn_11852 pDONR223 100% 41% 41% None 1_1623del n/a
5 ccsbBroad304_11852 pLX_304 0% 41% 41% V5 1_1623del n/a
Download CSV