Transcript: Human XM_011517073.2

PREDICTED: Homo sapiens family with sequence similarity 135 member B (FAM135B), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM135B (51059)
Length:
6119
CDS:
120..3653

Additional Resources:

NCBI RefSeq record:
XM_011517073.2
NBCI Gene record:
FAM135B (51059)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517073.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148493 CGGATCGGTTATTGGATGAAA pLKO.1 3004 CDS 100% 5.625 7.875 N FAM135B n/a
2 TRCN0000432350 CCTTGTCTTGTCTACCATAAA pLKO_005 797 CDS 100% 13.200 10.560 N FAM135B n/a
3 TRCN0000149592 CGGCTGGTAAAGACTTTCATA pLKO.1 2898 CDS 100% 5.625 4.500 N FAM135B n/a
4 TRCN0000148787 CCTAAAGACTTGAATGTGGGT pLKO.1 2142 CDS 100% 0.660 0.528 N FAM135B n/a
5 TRCN0000424218 AGCTTCTGATATACCATATTT pLKO_005 2789 CDS 100% 15.000 10.500 N FAM135B n/a
6 TRCN0000147284 GATGGACACATTTGCAGATTT pLKO.1 2972 CDS 100% 13.200 9.240 N FAM135B n/a
7 TRCN0000147851 GTGTTGAAACCAAAGGTCTTA pLKO.1 2035 CDS 100% 4.950 3.465 N FAM135B n/a
8 TRCN0000130961 CCTTTGGGATCCTTTGGAGTT pLKO.1 2628 CDS 100% 4.050 2.835 N FAM135B n/a
9 TRCN0000370804 GATTCTGATGAAGAAGTTATT pLKO_005 831 CDS 100% 13.200 6.600 Y ISCA1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517073.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14132 pDONR223 100% 89.3% None (many diffs) n/a
2 ccsbBroad304_14132 pLX_304 0% 89.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479306 TTAGTTGTGGATACGCTAGTAAGC pLX_317 10.8% 89.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_11939 pDONR223 100% 35% 35% None (many diffs) n/a
5 ccsbBroad304_11939 pLX_304 0% 35% 35% V5 (many diffs) n/a
6 TRCN0000468872 GTAGGGGCACATGCTACCCGTTCG pLX_317 33.9% 35% 35% V5 (many diffs) n/a
Download CSV