Transcript: Human XM_011517257.2

PREDICTED: Homo sapiens serine/threonine kinase 3 (STK3), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STK3 (6788)
Length:
3634
CDS:
1860..2801

Additional Resources:

NCBI RefSeq record:
XM_011517257.2
NBCI Gene record:
STK3 (6788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147084 TGGATTGTTATGGAGTACTG pXPR_003 TGG 557 59% 5 1.0242 STK3 STK3 75975
2 BRDN0001145644 GGATGTATATCAGCATAAGG pXPR_003 AGG 915 97% 7 -0.0397 STK3 STK3 75976
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350498 CCGGTCAAGTTGTCGCAATTA pLKO_005 2260 CDS 100% 13.200 18.480 N STK3 n/a
2 TRCN0000195190 CTGGAAATATTCTCCTCAATA pLKO.1 2560 CDS 100% 13.200 9.240 N STK3 n/a
3 TRCN0000380071 TGATTCAAGAAATAGGCTATA pLKO_005 2689 CDS 100% 10.800 7.560 N STK3 n/a
4 TRCN0000002174 GCAATACACAAGGAATCCGGT pLKO.1 2244 CDS 100% 0.660 0.462 N STK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14850 pDONR223 0% 39.2% 38.1% None (many diffs) n/a
2 ccsbBroad304_14850 pLX_304 20.5% 39.2% 38.1% V5 (many diffs) n/a
3 TRCN0000470542 TGTCTGCAAGTCTCTCTATTTCCC pLX_317 26.5% 39.2% 38.1% V5 (many diffs) n/a
4 TRCN0000491248 TCAACTCTAATCTCTCTTATATGC pLX_317 13.9% 39.2% 38.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488127 AACTCAATGCCCTACCTTGTAGCA pLX_317 20.6% 39.2% 38.1% V5 (many diffs) n/a
6 ccsbBroadEn_07012 pDONR223 100% 38.8% 38.1% None (many diffs) n/a
7 ccsbBroad304_07012 pLX_304 20.5% 38.8% 38.1% V5 (many diffs) n/a
8 TRCN0000475289 ACCGACTTGTTGACGCTCCGTCAA pLX_317 20.2% 38.8% 38.1% V5 (many diffs) n/a
Download CSV