Transcript: Human XM_011517363.3

PREDICTED: Homo sapiens transmembrane protein 67 (TMEM67), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM67 (91147)
Length:
3336
CDS:
16..2121

Additional Resources:

NCBI RefSeq record:
XM_011517363.3
NBCI Gene record:
TMEM67 (91147)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517363.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364986 ATTCGACAGTTCGTTGATTTA pLKO_005 1420 CDS 100% 13.200 18.480 N TMEM67 n/a
2 TRCN0000364926 TCCCATTGTGTGTAGTATTTA pLKO_005 2308 3UTR 100% 15.000 10.500 N TMEM67 n/a
3 TRCN0000369943 TTCGAGTTGCTACTCAAATAT pLKO_005 518 CDS 100% 15.000 10.500 N TMEM67 n/a
4 TRCN0000369902 TTACAATGATGAAGGTTATTC pLKO_005 1890 CDS 100% 13.200 9.240 N TMEM67 n/a
5 TRCN0000376511 GCGACAACAACCAGTACTTTG pLKO_005 161 CDS 100% 10.800 7.560 N TMEM67 n/a
6 TRCN0000146799 CCATCATTTGTCTCTGTAGAT pLKO.1 2425 3UTR 100% 4.950 3.465 N TMEM67 n/a
7 TRCN0000129134 GTCGTGTTCTTTGCTGTCTTT pLKO.1 1375 CDS 100% 4.950 3.465 N TMEM67 n/a
8 TRCN0000147047 CTCAGTATAATCATGGCCAAA pLKO.1 2146 3UTR 100% 4.050 2.835 N TMEM67 n/a
9 TRCN0000148737 CTGCCTGAATCTTCTCACATT pLKO.1 2464 3UTR 100% 4.950 2.970 N TMEM67 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2938 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2939 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517363.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12955 pDONR223 100% 69.4% 69.4% None 1_30del;404_405ins882 n/a
2 ccsbBroad304_12955 pLX_304 0% 69.4% 69.4% V5 1_30del;404_405ins882 n/a
3 TRCN0000468342 AAGCGGATAATGTGGCTTCTCGGT pLX_317 3.3% 69.4% 69.4% V5 1_30del;404_405ins882 n/a
Download CSV