Transcript: Human XM_011518194.2

PREDICTED: Homo sapiens WD repeat domain 31 (WDR31), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR31 (114987)
Length:
2820
CDS:
292..1320

Additional Resources:

NCBI RefSeq record:
XM_011518194.2
NBCI Gene record:
WDR31 (114987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146552 CAGAAGGTTTCGTTTAGGTTT pLKO.1 331 CDS 100% 4.950 3.960 N WDR31 n/a
2 TRCN0000243985 TCAGTGTTGTAAGTCCAATAA pLKO_005 1454 3UTR 100% 13.200 9.240 N WDR31 n/a
3 TRCN0000243986 CTCCACAGAAGGTTTCGTTTA pLKO_005 326 CDS 100% 10.800 7.560 N WDR31 n/a
4 TRCN0000150029 CATGATTGCAAGGTGAAGATT pLKO.1 1120 CDS 100% 5.625 3.938 N WDR31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04673 pDONR223 100% 92.9% 92.9% None 116_118delGCA;246_247ins75 n/a
2 ccsbBroad304_04673 pLX_304 0% 92.9% 92.9% V5 116_118delGCA;246_247ins75 n/a
3 TRCN0000470624 GCAATCACTTGGACAAACTCACCC pLX_317 41.8% 92.9% 92.9% V5 116_118delGCA;246_247ins75 n/a
Download CSV