Transcript: Human XM_011518823.3

PREDICTED: Homo sapiens syntaxin 17 (STX17), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STX17 (55014)
Length:
6734
CDS:
225..866

Additional Resources:

NCBI RefSeq record:
XM_011518823.3
NBCI Gene record:
STX17 (55014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518823.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060119 CGATCCAATATCCGAGAAATT pLKO.1 153 5UTR 100% 13.200 18.480 N STX17 n/a
2 TRCN0000380461 GAATCTGTAGAAGAACTTAAG pLKO_005 288 CDS 100% 10.800 7.560 N STX17 n/a
3 TRCN0000379933 TTGTTATCAGATAGCGAAATC pLKO_005 1297 3UTR 100% 10.800 7.560 N STX17 n/a
4 TRCN0000060118 CCTGTCTTCTAACACCTCAAA pLKO.1 1562 3UTR 100% 4.950 3.465 N STX17 n/a
5 TRCN0000060121 GCAGAATTTCTCCAACTCCAT pLKO.1 264 CDS 100% 2.640 1.848 N STX17 n/a
6 TRCN0000380045 GAGAATGATAGATCCTGTTAA pLKO_005 221 5UTR 100% 13.200 7.920 N STX17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518823.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12135 pDONR223 100% 17.1% 16.5% None (many diffs) n/a
2 ccsbBroad304_12135 pLX_304 0% 17.1% 16.5% V5 (many diffs) n/a
3 TRCN0000467994 TCGGGCTATCTAAAGCACTCATGG pLX_317 96.8% 17.1% 16.5% V5 (many diffs) n/a
Download CSV