Transcript: Human XM_011519172.3

PREDICTED: Homo sapiens far upstream element binding protein 3 (FUBP3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FUBP3 (8939)
Length:
2580
CDS:
47..1591

Additional Resources:

NCBI RefSeq record:
XM_011519172.3
NBCI Gene record:
FUBP3 (8939)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220168 CGGCGATTTCAACTCTCGAAT pLKO.1 778 CDS 100% 4.950 6.930 N FUBP3 n/a
2 TRCN0000220171 GCATATCATCAGCGAGCTGAT pLKO.1 988 CDS 100% 0.405 0.567 N FUBP3 n/a
3 TRCN0000220169 CCTGGCTTTCATAATGACATA pLKO.1 500 CDS 100% 4.950 3.465 N FUBP3 n/a
4 TRCN0000220170 CCTCTTCGTATCACTGGAGAT pLKO.1 677 CDS 100% 4.050 2.835 N FUBP3 n/a
5 TRCN0000220172 GACGGTAATAACGGAAGAATT pLKO.1 271 CDS 100% 0.000 0.000 N FUBP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11320 pDONR223 100% 48.4% 46.2% None (many diffs) n/a
2 ccsbBroad304_11320 pLX_304 0% 48.4% 46.2% V5 (many diffs) n/a
3 TRCN0000473445 ATCTCCGTTGTCTGGATAATCCTT pLX_317 50% 48.4% 46.2% V5 (many diffs) n/a
Download CSV