Transcript: Human XM_011519743.1

PREDICTED: Homo sapiens cullin 2 (CUL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CUL2 (8453)
Length:
4387
CDS:
201..2627

Additional Resources:

NCBI RefSeq record:
XM_011519743.1
NBCI Gene record:
CUL2 (8453)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006523 GCCCTTATTCAAGAGGTGATT pLKO.1 2481 CDS 100% 4.950 6.930 N CUL2 n/a
2 TRCN0000279894 GCCCTTATTCAAGAGGTGATT pLKO_005 2481 CDS 100% 4.950 6.930 N CUL2 n/a
3 TRCN0000006526 CCCTTGGAGAAAGACTTTATA pLKO.1 544 CDS 100% 15.000 10.500 N CUL2 n/a
4 TRCN0000297278 CCCTTGGAGAAAGACTTTATA pLKO_005 544 CDS 100% 15.000 10.500 N CUL2 n/a
5 TRCN0000006525 GCAAGCTACATCGGATGTATA pLKO.1 1801 CDS 100% 13.200 9.240 N CUL2 n/a
6 TRCN0000279966 GCAAGCTACATCGGATGTATA pLKO_005 1801 CDS 100% 13.200 9.240 N CUL2 n/a
7 TRCN0000006522 CGTTTGCAGTTGATGTGTCTT pLKO.1 2913 3UTR 100% 4.950 3.465 N CUL2 n/a
8 TRCN0000279965 CGTTTGCAGTTGATGTGTCTT pLKO_005 2913 3UTR 100% 4.950 3.465 N CUL2 n/a
9 TRCN0000006524 GCAGACTATATGGACTGCTTA pLKO.1 681 CDS 100% 4.950 3.465 N CUL2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3949 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3949 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01930 pDONR223 100% 92.2% 92.2% None 1_189del n/a
2 ccsbBroad304_01930 pLX_304 0% 92.2% 92.2% V5 1_189del n/a
3 TRCN0000480690 ACCCTTATATAATGGCCCACTCCA pLX_317 18.1% 92.2% 92.2% V5 1_189del n/a
Download CSV