Transcript: Human XM_011519754.3

PREDICTED: Homo sapiens pre-mRNA processing factor 18 (PRPF18), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRPF18 (8559)
Length:
16306
CDS:
319..1302

Additional Resources:

NCBI RefSeq record:
XM_011519754.3
NBCI Gene record:
PRPF18 (8559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519754.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010512 GACGAAACTCAGCGGAAATAT pLKO.1 1195 CDS 100% 15.000 12.000 N PRPF18 n/a
2 TRCN0000314724 GACGAAACTCAGCGGAAATAT pLKO_005 1195 CDS 100% 15.000 12.000 N PRPF18 n/a
3 TRCN0000000016 GATCTGTGTATGGTGTGTTAA pLKO.1 1303 CDS 100% 13.200 9.240 N PRPF18 n/a
4 TRCN0000314726 GATCTGTGTATGGTGTGTTAA pLKO_005 1303 CDS 100% 13.200 9.240 N PRPF18 n/a
5 TRCN0000000019 GAATACGTGAAGGCAAATGAT pLKO.1 1054 CDS 100% 5.625 3.938 N PRPF18 n/a
6 TRCN0000000018 GACTATTTGGAGAGACTGATT pLKO.1 560 CDS 100% 4.950 3.465 N PRPF18 n/a
7 TRCN0000000017 GAGGAGAACCAATCAGACTAT pLKO.1 545 CDS 100% 4.950 3.465 N PRPF18 n/a
8 TRCN0000314723 GAGGAGAACCAATCAGACTAT pLKO_005 545 CDS 100% 4.950 3.465 N PRPF18 n/a
9 TRCN0000314652 GGAATCTTCCTGCTGATATTA pLKO_005 992 CDS 100% 15.000 9.000 N PRPF18 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3041 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000180418 GATCACTTGAGCTCAGGAGTT pLKO.1 7160 3UTR 100% 4.050 2.025 Y ERN2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3042 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000148774 CCATGTGTTCTCATTGTTCAA pLKO.1 6060 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
14 TRCN0000162188 CCATGTGTTCTCATTGTTCAA pLKO.1 6060 3UTR 100% 4.950 2.475 Y SPC25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519754.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07263 pDONR223 100% 94.9% 93.8% None (many diffs) n/a
2 ccsbBroad304_07263 pLX_304 0% 94.9% 93.8% V5 (many diffs) n/a
3 TRCN0000480692 TTCAGCATCACCTTTAACGAACCA pLX_317 42.2% 94.9% 93.8% V5 (many diffs) n/a
Download CSV