Transcript: Human XM_011520577.2

PREDICTED: Homo sapiens lamin tail domain containing 1 (LMNTD1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LMNTD1 (160492)
Length:
2013
CDS:
762..1991

Additional Resources:

NCBI RefSeq record:
XM_011520577.2
NBCI Gene record:
LMNTD1 (160492)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431975 CATCGTAATGCAGGCAAATTC pLKO_005 1409 CDS 100% 13.200 18.480 N LMNTD1 n/a
2 TRCN0000415821 GATTAGTAGAGTAACTATATC pLKO_005 986 CDS 100% 13.200 18.480 N LMNTD1 n/a
3 TRCN0000117263 CCTCTGATTGAACCACACAAT pLKO.1 1860 CDS 100% 4.950 6.930 N LMNTD1 n/a
4 TRCN0000433159 TAGATGCTGACGTTGAATTTA pLKO_005 1609 CDS 100% 15.000 12.000 N LMNTD1 n/a
5 TRCN0000117266 GAAGACAAACTTGGAGTATAT pLKO.1 855 CDS 100% 13.200 10.560 N LMNTD1 n/a
6 TRCN0000426995 GAATGCCTCTTGGTTACTATC pLKO_005 952 CDS 100% 10.800 8.640 N LMNTD1 n/a
7 TRCN0000117264 CCCTTGACAAAGAAATGGCAA pLKO.1 1321 CDS 100% 2.640 2.112 N LMNTD1 n/a
8 TRCN0000117265 CCCTTCTCAGTTCCGAAGAAA pLKO.1 1080 CDS 100% 5.625 3.938 N LMNTD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13317 pDONR223 100% 71% 70.9% None 1_354del;1159A>T n/a
2 ccsbBroad304_13317 pLX_304 0% 71% 70.9% V5 1_354del;1159A>T n/a
3 TRCN0000469727 CTAACCTTCTGAAAAATGCTGCCT pLX_317 55.9% 71% 70.9% V5 1_354del;1159A>T n/a
Download CSV