Transcript: Human XM_011520696.2

PREDICTED: Homo sapiens phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma (PIK3C2G), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIK3C2G (5288)
Length:
4687
CDS:
245..4672

Additional Resources:

NCBI RefSeq record:
XM_011520696.2
NBCI Gene record:
PIK3C2G (5288)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378589 TGGATATGCAAATGATCATTT pLKO_005 3210 CDS 100% 13.200 18.480 N PIK3C2G n/a
2 TRCN0000378673 TTTATGCCATGTGCTAATTAT pLKO_005 1151 CDS 100% 15.000 10.500 N PIK3C2G n/a
3 TRCN0000356270 CTAAGGTGCAGTTAGTCATAT pLKO_005 4356 CDS 100% 13.200 9.240 N PIK3C2G n/a
4 TRCN0000196621 GTGCTAATTATCTTGTCAAAG pLKO.1 1161 CDS 100% 10.800 7.560 N PIK3C2G n/a
5 TRCN0000195256 CCACCTGAAATACCTATTGAA pLKO.1 1489 CDS 100% 5.625 3.938 N PIK3C2G n/a
6 TRCN0000002340 GCAGAAGAATATAGAGTCAAT pLKO.1 907 CDS 100% 4.950 3.465 N PIK3C2G n/a
7 TRCN0000002339 CCTGCTGGAAATGATGCTGTA pLKO.1 3712 CDS 100% 4.050 2.835 N PIK3C2G n/a
8 TRCN0000002338 GCAGTATGAACACCAAGAATT pLKO.1 295 CDS 100% 0.000 0.000 N PIK3C2G n/a
9 TRCN0000002337 CCTGGAAGCAACAAGTCATTT pLKO.1 3808 CDS 100% 13.200 7.920 N PIK3C2G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14757 pDONR223 38.4% 94.4% 78.9% None (many diffs) n/a
2 ccsbBroad304_14757 pLX_304 0% 94.4% 78.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469462 TCACCCTAAAAATAAACTTTCACC pLX_317 8.2% 94.4% 78.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV