Transcript: Human XM_011521491.1

PREDICTED: Homo sapiens amyloid beta precursor protein binding family A member 2 (APBA2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APBA2 (321)
Length:
3050
CDS:
223..2472

Additional Resources:

NCBI RefSeq record:
XM_011521491.1
NBCI Gene record:
APBA2 (321)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425029 GGTCACCACGGTCCTTATCAA pLKO_005 2190 CDS 100% 5.625 7.875 N APBA2 n/a
2 TRCN0000432529 ATCGTGGCAGAGATCAAGATG pLKO_005 907 CDS 100% 4.950 6.930 N APBA2 n/a
3 TRCN0000063876 GCACACCCTGTGGACACTGAT pLKO.1 598 CDS 100% 1.650 1.320 N APBA2 n/a
4 TRCN0000431146 TCATCGACGGGATCATCTTTG pLKO_005 1319 CDS 100% 10.800 7.560 N APBA2 n/a
5 TRCN0000417705 AGAGTCACAGAACAAATGTTT pLKO_005 2665 3UTR 100% 5.625 3.938 N APBA2 n/a
6 TRCN0000427562 CAACACCCAGGAGATGTACAA pLKO_005 1863 CDS 100% 4.950 3.465 N APBA2 n/a
7 TRCN0000436680 CCACGTTCTGGACTGTCTTCT pLKO_005 2712 3UTR 100% 4.950 3.465 N APBA2 n/a
8 TRCN0000435642 CCAGCTCTGACTACGTGAACA pLKO_005 437 CDS 100% 4.950 3.465 N APBA2 n/a
9 TRCN0000063877 TCTGATCTCAATGGACCTGTT pLKO.1 1213 CDS 100% 4.050 2.835 N APBA2 n/a
10 TRCN0000430294 TGCGTACCATCTCCTACATCG pLKO_005 1583 CDS 100% 4.050 2.835 N APBA2 n/a
11 TRCN0000063875 GCCGGGTCAAGAGGATGCAAA pLKO.1 1427 CDS 100% 1.650 1.155 N APBA2 n/a
12 TRCN0000063873 CCACTTCTCAAACTCGGAGAA pLKO.1 1896 CDS 100% 0.405 0.284 N APBA2 n/a
13 TRCN0000063874 CCAGAAGGAATACAGCGACAT pLKO.1 1839 CDS 100% 4.050 2.430 N APBA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05830 pDONR223 100% 98.3% 98.2% None 932T>C;1215_1250del;1809C>T n/a
2 ccsbBroad304_05830 pLX_304 0% 98.3% 98.2% V5 932T>C;1215_1250del;1809C>T n/a
3 TRCN0000477800 GTGCTTAGGGTTCGAATAACGTTA pLX_317 8.5% 98.3% 98.2% V5 932T>C;1215_1250del;1809C>T n/a
Download CSV