Transcript: Human XM_011521560.1

PREDICTED: Homo sapiens SMAD family member 3 (SMAD3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMAD3 (4088)
Length:
6174
CDS:
385..1515

Additional Resources:

NCBI RefSeq record:
XM_011521560.1
NBCI Gene record:
SMAD3 (4088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521560.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020009 CTGTGTGAGTTCGCCTTCAAT pLKO.1 559 CDS 100% 5.625 7.875 N SMAD3 n/a
2 TRCN0000330055 GCCTCAGTGACAGCGCTATTT pLKO_005 1157 CDS 100% 13.200 9.240 N SMAD3 n/a
3 TRCN0000330128 TGAGCAGAACAGGTAGTATTA pLKO_005 1778 3UTR 100% 13.200 9.240 N SMAD3 n/a
4 TRCN0000330056 GGATTGAGCTGCACCTGAATG pLKO_005 1421 CDS 100% 10.800 7.560 N SMAD3 n/a
5 TRCN0000353587 TCCGCATGAGCTTCGTCAAAG pLKO_005 1352 CDS 100% 10.800 7.560 N SMAD3 n/a
6 TRCN0000020010 CCGCTGTTCCAGTGTGTCTTA pLKO.1 1494 CDS 100% 4.950 3.465 N SMAD3 n/a
7 TRCN0000020012 CATCTCCTACTACGAGCTGAA pLKO.1 939 CDS 100% 4.050 2.835 N SMAD3 n/a
8 TRCN0000020011 CCCAGCACATAATAACTTGGA pLKO.1 876 CDS 100% 2.640 1.848 N SMAD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521560.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06549 pDONR223 100% 84.9% 83.4% None (many diffs) n/a
2 ccsbBroad304_06549 pLX_304 52.9% 84.9% 83.4% V5 (many diffs) n/a
3 TRCN0000469603 CAAACTTGGTTGGCATGCAAAGAT pLX_317 28.1% 84.9% 83.4% V5 (many diffs) n/a
Download CSV