Transcript: Human XM_011522010.2

PREDICTED: Homo sapiens interactor of little elongation complex ELL subunit 2 (ICE2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ICE2 (79664)
Length:
3578
CDS:
405..2942

Additional Resources:

NCBI RefSeq record:
XM_011522010.2
NBCI Gene record:
ICE2 (79664)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152950 GCACCAGACATTTCTGCTAAT pLKO.1 1329 CDS 100% 10.800 15.120 N ICE2 n/a
2 TRCN0000153176 GCTCAGCAAGTTGAAACTGAA pLKO.1 2889 CDS 100% 4.950 3.960 N ICE2 n/a
3 TRCN0000157640 CCAGACCAGCTAGTCCAAATT pLKO.1 1795 CDS 100% 13.200 9.240 N ICE2 n/a
4 TRCN0000153157 GCCACTGCTGAAGATGATTAT pLKO.1 3336 3UTR 100% 13.200 9.240 N ICE2 n/a
5 TRCN0000152505 GCTGATGGTGAAAGACCTAAT pLKO.1 1602 CDS 100% 10.800 7.560 N ICE2 n/a
6 TRCN0000152747 GCTACCATTGAAACGTCAGAA pLKO.1 732 CDS 100% 4.950 3.465 N ICE2 n/a
7 TRCN0000150652 GCTTGCATTGAACAAGTGAAA pLKO.1 534 CDS 100% 4.950 3.465 N ICE2 n/a
8 TRCN0000150506 GATGATTATGAGCATCGCAAA pLKO.1 3348 3UTR 100% 4.050 2.835 N ICE2 n/a
9 TRCN0000156804 GCAGAGGAGTTATGTGGACTT pLKO.1 305 5UTR 100% 4.050 2.835 N ICE2 n/a
10 TRCN0000158028 CCACAGGAATCCAGTTTCCAT pLKO.1 2843 CDS 100% 3.000 2.100 N ICE2 n/a
11 TRCN0000151110 GCTGAAGATGATTATGAGCAT pLKO.1 3342 3UTR 100% 2.640 1.848 N ICE2 n/a
12 TRCN0000153322 GCTCTGACTGAAAGTGAACTT pLKO.1 2346 CDS 100% 4.950 2.970 N ICE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12587 pDONR223 100% 39.2% 39.2% None 1_1539del;1932T>C n/a
2 TRCN0000468764 ATAATGACACAGGATGTCATCAAC pLX_317 41% 39.2% 39.2% V5 1_1539del;1932T>C n/a
Download CSV