Transcript: Human XM_011522013.2

PREDICTED: Homo sapiens leucine rich repeat kinase 1 (LRRK1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRK1 (79705)
Length:
8379
CDS:
343..6390

Additional Resources:

NCBI RefSeq record:
XM_011522013.2
NBCI Gene record:
LRRK1 (79705)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380192 TCTACTTCCTCGACCCTATTT pLKO_005 3098 CDS 100% 13.200 18.480 N LRRK1 n/a
2 TRCN0000007041 CGGTGGAGATGTTATCGTCAT pLKO.1 6114 CDS 100% 4.050 5.670 N LRRK1 n/a
3 TRCN0000350494 CGGTGGAGATGTTATCGTCAT pLKO_005 6114 CDS 100% 4.050 5.670 N LRRK1 n/a
4 TRCN0000088829 GCCCTCATGTTCTTGAGGTTA pLKO.1 1762 CDS 100% 0.495 0.693 N Lrrk1 n/a
5 TRCN0000199833 GCCGAGTCATTGCCGTCTTAA pLKO.1 6167 CDS 100% 13.200 10.560 N LRRK1 n/a
6 TRCN0000315173 ACACCATTCAGAGGGTATTTA pLKO_005 3377 CDS 100% 15.000 10.500 N LRRK1 n/a
7 TRCN0000007038 CCCAGGTCTCAGATGGAATTA pLKO.1 6757 3UTR 100% 13.200 9.240 N LRRK1 n/a
8 TRCN0000315172 CCCAGGTCTCAGATGGAATTA pLKO_005 6757 3UTR 100% 13.200 9.240 N LRRK1 n/a
9 TRCN0000007039 CGCCAGAGATTCTTCCTTTAT pLKO.1 4389 CDS 100% 13.200 9.240 N LRRK1 n/a
10 TRCN0000315171 CGCCAGAGATTCTTCCTTTAT pLKO_005 4389 CDS 100% 13.200 9.240 N LRRK1 n/a
11 TRCN0000315243 GGCTACTTGAAATTGACATTT pLKO_005 1331 CDS 100% 13.200 9.240 N LRRK1 n/a
12 TRCN0000379976 ACGTGCCATGGAGACGCTTAA pLKO_005 417 CDS 100% 10.800 7.560 N LRRK1 n/a
13 TRCN0000007040 CCAACACCATTCAGAGGGTAT pLKO.1 3374 CDS 100% 4.050 2.835 N LRRK1 n/a
14 TRCN0000007042 CCTGGATTTAATTGAAGCCAA pLKO.1 2616 CDS 100% 2.640 1.848 N LRRK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489245 CTGCCTTATAAACTAAGGTCTGGC pLX_317 7.1% 64.9% 65% V5 (not translated due to prior stop codon) 1_2115del;3447A>G n/a
2 TRCN0000489672 GCTATGCTTATTTCGCATCCGCTT pLX_317 8% 64.9% 64.9% V5 1_2115del;3447A>G;6045_6046insG n/a
Download CSV