Transcript: Human XM_011522192.2

PREDICTED: Homo sapiens protein regulator of cytokinesis 1 (PRC1), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRC1 (9055)
Length:
2245
CDS:
160..1704

Additional Resources:

NCBI RefSeq record:
XM_011522192.2
NBCI Gene record:
PRC1 (9055)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165472 GCGAGTTACATGTTGAGCCAT pLKO.1 401 CDS 100% 2.640 3.696 N PRC1 n/a
2 TRCN0000280716 GCGAGTTACATGTTGAGCCAT pLKO_005 401 CDS 100% 2.640 3.696 N PRC1 n/a
3 TRCN0000158609 CAGGAACATTCAAAGGCATTT pLKO.1 1081 CDS 100% 10.800 7.560 N PRC1 n/a
4 TRCN0000280793 CAGGAACATTCAAAGGCATTT pLKO_005 1081 CDS 100% 10.800 7.560 N PRC1 n/a
5 TRCN0000161833 GCACGAATTGAATTGTGGGAA pLKO.1 1060 CDS 100% 2.640 1.848 N PRC1 n/a
6 TRCN0000162697 CCTCCTGAAGAGAATGTCTTT pLKO.1 1639 CDS 100% 4.950 2.970 N PRC1 n/a
7 TRCN0000280717 CCTCCTGAAGAGAATGTCTTT pLKO_005 1639 CDS 100% 4.950 2.970 N PRC1 n/a
8 TRCN0000160679 CCTGAAGGAAAGACTCATCAA pLKO.1 339 CDS 100% 4.950 2.970 N PRC1 n/a
9 TRCN0000280715 CCTGAAGGAAAGACTCATCAA pLKO_005 339 CDS 100% 4.950 2.970 N PRC1 n/a
10 TRCN0000159775 GCAGCTTTGTTAAATTGTGTT pLKO.1 1719 3UTR 100% 4.950 2.970 N PRC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469291 AATGTGGCGCTTGATACCTCTACG pLX_317 25.4% 79.2% 77.7% V5 (many diffs) n/a
2 ccsbBroadEn_07350 pDONR223 100% 79.2% 77.1% None (many diffs) n/a
3 ccsbBroad304_07350 pLX_304 0% 79.2% 77.1% V5 (many diffs) n/a
4 TRCN0000489660 GTCCCGTAACCTCCCTTGCCCTTA pLX_317 20.4% 79.2% 77.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_11330 pDONR223 100% 72.5% 72.3% None (many diffs) n/a
6 ccsbBroad304_11330 pLX_304 0% 72.5% 72.3% V5 (many diffs) n/a
7 TRCN0000471579 CCGTCGCCTAATCAAGACTCAACG pLX_317 17.5% 72.5% 72.3% V5 (many diffs) n/a
Download CSV