Transcript: Human XM_011522801.2

PREDICTED: Homo sapiens cadherin 5 (CDH5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDH5 (1003)
Length:
4118
CDS:
122..2503

Additional Resources:

NCBI RefSeq record:
XM_011522801.2
NBCI Gene record:
CDH5 (1003)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522801.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054089 CCTCACGGATAATCACGATAA pLKO.1 1723 CDS 100% 10.800 15.120 N CDH5 n/a
2 TRCN0000054090 CGTGGATTACGACTTCCTTAA pLKO.1 2410 CDS 100% 10.800 15.120 N CDH5 n/a
3 TRCN0000054091 CCGCAATAGACAAGGACATAA pLKO.1 1650 CDS 100% 13.200 10.560 N CDH5 n/a
4 TRCN0000425046 ACGAAACGTGAAGTTCAAATT pLKO_005 1675 CDS 100% 13.200 9.240 N CDH5 n/a
5 TRCN0000054088 CGCCTCTGTCATGTACCAAAT pLKO.1 679 CDS 100% 10.800 7.560 N CDH5 n/a
6 TRCN0000431665 TCACGCATCGGTTGTTCAATG pLKO_005 573 CDS 100% 10.800 7.560 N CDH5 n/a
7 TRCN0000054092 GAGTCGCAAGAATGCCAAGTA pLKO.1 346 CDS 100% 4.950 3.465 N CDH5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522801.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10723 pDONR223 100% 84.2% 84.1% None (many diffs) n/a
2 ccsbBroad304_10723 pLX_304 0% 84.2% 84.1% V5 (many diffs) n/a
3 TRCN0000477792 CAGTAGATAGTGAGCTCATATAAC pLX_317 18% 84.2% 84.1% V5 (many diffs) n/a
Download CSV