Transcript: Human XM_011523606.3

PREDICTED: Homo sapiens cytochrome b-245 chaperone 1 (CYBC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYBC1 (79415)
Length:
3096
CDS:
1121..1783

Additional Resources:

NCBI RefSeq record:
XM_011523606.3
NBCI Gene record:
CYBC1 (79415)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523606.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180756 GCTTGCACACTGCATGAAACA pLKO.1 2030 3UTR 100% 4.950 3.960 N CYBC1 n/a
2 TRCN0000180403 GCTGGTTGGAATCTTGTCGAT pLKO.1 1297 CDS 100% 2.640 2.112 N CYBC1 n/a
3 TRCN0000179864 CAGCAAGATCCTGTCTTTGTA pLKO.1 2628 3UTR 100% 5.625 3.938 N CYBC1 n/a
4 TRCN0000180821 GCAGTGGTTCATGCCAGTAAT pLKO.1 2537 3UTR 100% 13.200 7.920 N CYBC1 n/a
5 TRCN0000181063 CTCACACTCAGCTTCAGCATA pLKO.1 2442 3UTR 100% 4.950 2.970 N CYBC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523606.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04074 pDONR223 100% 85% 85% None 1_99del n/a
2 ccsbBroad304_04074 pLX_304 0% 85% 85% V5 1_99del n/a
3 TRCN0000469325 AATCTTAATGATTTTACGCACATA pLX_317 62.6% 85% 85% V5 1_99del n/a
Download CSV