Transcript: Human XM_011524108.1

PREDICTED: Homo sapiens small G protein signaling modulator 2 (SGSM2), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGSM2 (9905)
Length:
3899
CDS:
76..3114

Additional Resources:

NCBI RefSeq record:
XM_011524108.1
NBCI Gene record:
SGSM2 (9905)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155555 CACATCTCATCGGAGCACTTT pLKO.1 2893 CDS 100% 4.950 6.930 N SGSM2 n/a
2 TRCN0000155301 GCAAGTTTACTACGGAGGCAT pLKO.1 1755 CDS 100% 2.640 3.696 N SGSM2 n/a
3 TRCN0000271655 AGCATTCGCTCCGTGGATATG pLKO_005 1270 CDS 100% 10.800 8.640 N SGSM2 n/a
4 TRCN0000271657 ACTGCCCTCCTCTCGCAATTA pLKO_005 2193 CDS 100% 13.200 9.240 N SGSM2 n/a
5 TRCN0000271653 TGTGCGGCTGCCTACACTATA pLKO_005 2407 CDS 100% 13.200 9.240 N SGSM2 n/a
6 TRCN0000093181 CCGTGACAACAACATGGACTT pLKO.1 2961 CDS 100% 4.050 2.835 N Sgsm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14032 pDONR223 100% 94.3% 17.5% None (many diffs) n/a
2 ccsbBroad304_14032 pLX_304 0% 94.3% 17.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477986 TCTGCATGAAGTGAAGCCCGGGGC pLX_317 9.1% 94.3% 17.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV