Transcript: Human XM_011524344.1

PREDICTED: Homo sapiens chorionic somatomammotropin hormone like 1 (CSHL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CSHL1 (1444)
Length:
1093
CDS:
63..848

Additional Resources:

NCBI RefSeq record:
XM_011524344.1
NBCI Gene record:
CSHL1 (1444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158298 CAGGAGTACCTTCACCAACAA pLKO.1 434 CDS 100% 4.950 2.970 N CSHL1 n/a
2 TRCN0000156479 CTTCACCAACAACCTGGTGTA pLKO.1 443 CDS 100% 0.405 0.243 N CSHL1 n/a
3 TRCN0000371925 TTCTGCTTCTCAGACTCTATT pLKO_005 309 CDS 100% 13.200 6.600 Y CSH1 n/a
4 TRCN0000377769 ATGGACAAGGTCGAGACATTC pLKO_005 916 3UTR 100% 10.800 5.400 Y CSH1 n/a
5 TRCN0000155751 CGATGACTATCACCTCCTAAA pLKO.1 479 CDS 100% 10.800 5.400 Y CSHL1 n/a
6 TRCN0000432549 ACATGGACAAGGTCGAGACAT pLKO_005 914 3UTR 100% 4.950 2.475 Y CSHL1 n/a
7 TRCN0000372356 ACCTAGAGGAAGGCATCCAAA pLKO_005 502 CDS 100% 4.950 2.475 Y GH1 n/a
8 TRCN0000157795 CAAGCAGACCTACAGCAAGTT pLKO.1 825 CDS 100% 4.950 2.475 Y CSHL1 n/a
9 TRCN0000166034 CATGGACAAGGTCGAGACATT pLKO.1 915 3UTR 100% 4.950 2.475 Y CSH2 n/a
10 TRCN0000083816 CTACAGCAAGTTTGACACAAA pLKO.1 834 CDS 100% 4.950 2.475 Y CSH1 n/a
11 TRCN0000166095 GCAGACCTACAGCAAGTTTGA pLKO.1 828 CDS 100% 4.950 2.475 Y CSH2 n/a
12 TRCN0000083813 GCGATGACTATCACCTCCTAA pLKO.1 478 CDS 100% 4.950 2.475 Y CSH1 n/a
13 TRCN0000156711 GCGATGACTATCACCTCCTAA pLKO.1 478 CDS 100% 4.950 2.475 Y CSHL1 n/a
14 TRCN0000415757 ACGCACTGCTCAAGAACTACG pLKO_005 869 3UTR 100% 4.050 2.025 Y CSHL1 n/a
15 TRCN0000155156 GTTTGACACAAACTCGCACAA pLKO.1 843 CDS 100% 4.050 2.025 Y CSHL1 n/a
16 TRCN0000156733 GACACAAACTCGCACAACCAT pLKO.1 847 CDS 100% 3.000 1.500 Y CSHL1 n/a
17 TRCN0000160300 CAGAAGTATTCATTCCTGCAT pLKO.1 273 CDS 100% 2.640 1.320 Y CSH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00374 pDONR223 100% 71.6% 55.9% None (many diffs) n/a
2 ccsbBroad304_00374 pLX_304 0% 71.6% 55.9% V5 (many diffs) n/a
3 TRCN0000466754 AAACTGCTGAAATAACCAGGGAGG pLX_317 61.2% 71.6% 55.9% V5 (many diffs) n/a
4 ccsbBroadEn_06051 pDONR223 100% 71.4% 55.5% None (many diffs) n/a
5 ccsbBroad304_06051 pLX_304 0% 71.4% 55.5% V5 (many diffs) n/a
6 TRCN0000478974 TTCTAGGTATACTATTGCAGTGAG pLX_317 59.7% 71.4% 55.5% V5 (many diffs) n/a
7 ccsbBroadEn_00373 pDONR223 100% 71.3% 55.5% None (many diffs) n/a
8 ccsbBroad304_00373 pLX_304 0% 71.3% 55.5% V5 (many diffs) n/a
9 TRCN0000469020 CTTCGCCCGGCGTACGAATCACCC pLX_317 54.8% 71.3% 55.5% V5 (many diffs) n/a
10 ccsbBroadEn_15390 pDONR223 0% 70.4% 55.5% None (many diffs) n/a
11 ccsbBroad304_15390 pLX_304 0% 70.4% 55.5% V5 (many diffs) n/a
12 TRCN0000478638 GCAGCTCCTCTCTGGAGCAATCTC pLX_317 59.7% 70.4% 55.5% V5 (many diffs) n/a
13 ccsbBroadEn_00375 pDONR223 100% 40.8% 27.6% None (many diffs) n/a
14 ccsbBroad304_00375 pLX_304 0% 40.8% 27.6% V5 (many diffs) n/a
15 TRCN0000475609 ATAACCGATCTTCGAGTCTGGGAC pLX_317 61.6% 40.8% 27.6% V5 (many diffs) n/a
16 ccsbBroadEn_06052 pDONR223 100% 40.5% 27.3% None (many diffs) n/a
17 ccsbBroad304_06052 pLX_304 0% 40.5% 27.3% V5 (many diffs) n/a
18 TRCN0000466000 TAACGGGGAACGTTCGTTGATAAT pLX_317 85% 40.5% 27.3% V5 (many diffs) n/a
Download CSV